\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610205132:

Variant ID: vg0610205132 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 10205132
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.56, G: 0.44, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:


TCGTCCAGGAATCATCCGAGGTTTATAAACTGACAATTTAATATACAAATCCATCATAATAATAATGTTACATATTTACAAAAGAAAAGAAAATAGCAGC[A/G]
GATAAACGGTCTAGCGATGGCATCATATCCACTCCCACAGGCAGCTTAATTGGGGTATAAGCCAAACGTCTTCTGCTTCGAATCTTTTCTTCAACTGGGG

Reverse complement sequence

CCCCAGTTGAAGAAAAGATTCGAAGCAGAAGACGTTTGGCTTATACCCCAATTAAGCTGCCTGTGGGAGTGGATATGATGCCATCGCTAGACCGTTTATC[T/C]
GCTGCTATTTTCTTTTCTTTTGTAAATATGTAACATTATTATTATGATGGATTTGTATATTAAATTGTCAGTTTATAAACCTCGGATGATTCCTGGACGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.20% 11.80% 0.19% 3.87% NA
All Indica  2759 85.50% 8.90% 0.25% 5.36% NA
All Japonica  1512 81.50% 16.90% 0.13% 1.46% NA
Aus  269 82.50% 17.10% 0.00% 0.37% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 91.00% 2.80% 0.86% 5.38% NA
Indica III  913 72.30% 16.90% 0.22% 10.62% NA
Indica Intermediate  786 87.30% 9.30% 0.13% 3.31% NA
Temperate Japonica  767 66.50% 31.80% 0.26% 1.43% NA
Tropical Japonica  504 99.20% 0.20% 0.00% 0.60% NA
Japonica Intermediate  241 92.10% 4.60% 0.00% 3.32% NA
VI/Aromatic  96 87.50% 4.20% 0.00% 8.33% NA
Intermediate  90 88.90% 6.70% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610205132 A -> G LOC_Os06g17580.1 upstream_gene_variant ; 2197.0bp to feature; MODIFIER silent_mutation Average:25.782; most accessible tissue: Zhenshan97 young leaf, score: 52.657 N N N N
vg0610205132 A -> G LOC_Os06g17590.1 upstream_gene_variant ; 4023.0bp to feature; MODIFIER silent_mutation Average:25.782; most accessible tissue: Zhenshan97 young leaf, score: 52.657 N N N N
vg0610205132 A -> G LOC_Os06g17580-LOC_Os06g17590 intergenic_region ; MODIFIER silent_mutation Average:25.782; most accessible tissue: Zhenshan97 young leaf, score: 52.657 N N N N
vg0610205132 A -> DEL N N silent_mutation Average:25.782; most accessible tissue: Zhenshan97 young leaf, score: 52.657 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610205132 7.78E-07 1.32E-09 Awn_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0610205132 3.05E-07 1.71E-11 mr1065 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 2.45E-09 3.67E-14 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 9.88E-10 5.13E-13 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 6.14E-11 8.24E-16 mr1087 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 4.68E-11 1.09E-13 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 5.07E-06 NA mr1091 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 NA 2.20E-06 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 1.26E-06 8.74E-10 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 NA 1.42E-09 mr1108 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 6.08E-06 4.94E-10 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 NA 2.84E-09 mr1112 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 5.35E-07 2.78E-10 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 7.24E-07 1.89E-11 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 NA 8.11E-09 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 NA 6.82E-09 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 5.08E-08 8.69E-11 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 1.81E-08 9.32E-14 mr1695 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 2.24E-09 2.03E-10 mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 4.35E-06 NA mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 3.13E-13 2.75E-16 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 1.40E-08 1.60E-09 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 4.71E-07 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 1.22E-13 1.03E-15 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 2.74E-13 4.31E-13 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 1.23E-07 NA mr1091_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 1.05E-09 NA mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 NA 1.64E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 7.96E-07 8.75E-07 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 1.57E-10 6.69E-11 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 4.01E-08 NA mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 6.37E-12 2.21E-12 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 4.41E-09 1.22E-10 mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 3.34E-08 8.90E-10 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 1.79E-11 1.09E-12 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 3.71E-08 3.17E-10 mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 2.61E-09 2.23E-10 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 NA 1.37E-07 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 2.01E-07 NA mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 5.60E-11 1.22E-13 mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610205132 7.56E-12 9.10E-14 mr1695_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251