\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0610116533:

Variant ID: vg0610116533 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 10116533
Reference Allele: TAAAAlternative Allele: TAA,AAAA,TAAAA,TA,T
Primary Allele: TAAASecondary Allele: AAAA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATAGCAGTATCATGTAAAAGCAGAGTCATCCTTCTCTTTCTCTCCTTCTCCATACGTGTTTGGATGAAAAGCAAAATAAAATTTTAAGAGTATGTTTTTT[TAAA/TAA,AAAA,TAAAA,TA,T]
AAAAAATTACACAGTACAACGTAGACACTTACAACGCATGCACACTCACCCCTATGAACCCGCGCACGCAAACCCTACCCTTATGAGCATCTTCGAAGAC

Reverse complement sequence

GTCTTCGAAGATGCTCATAAGGGTAGGGTTTGCGTGCGCGGGTTCATAGGGGTGAGTGTGCATGCGTTGTAAGTGTCTACGTTGTACTGTGTAATTTTTT[TTTA/TTA,TTTT,TTTTA,TA,A]
AAAAAACATACTCTTAAAATTTTATTTTGCTTTTCATCCAAACACGTATGGAGAAGGAGAGAAAGAGAAGGATGACTCTGCTTTTACATGATACTGCTAT

Allele Frequencies:

Populations Population SizeFrequency of TAAA(primary allele) Frequency of AAAA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.40% 34.00% 0.21% 0.00% TAA: 24.02%; TA: 0.21%; TAAAA: 0.13%; T: 0.02%
All Indica  2759 50.60% 46.30% 0.22% 0.00% TAA: 2.72%; TAAAA: 0.18%; T: 0.04%
All Japonica  1512 32.10% 18.10% 0.07% 0.00% TAA: 49.14%; TA: 0.53%; TAAAA: 0.07%
Aus  269 16.70% 1.50% 0.00% 0.00% TAA: 81.04%; TA: 0.74%
Indica I  595 66.70% 26.70% 0.50% 0.00% TAA: 5.88%; TAAAA: 0.17%
Indica II  465 14.40% 84.10% 0.22% 0.00% TAA: 0.65%; TAAAA: 0.43%; T: 0.22%
Indica III  913 60.60% 37.90% 0.00% 0.00% TAA: 1.31%; TAAAA: 0.22%
Indica Intermediate  786 48.10% 48.50% 0.25% 0.00% TAA: 3.18%
Temperate Japonica  767 56.50% 7.00% 0.13% 0.00% TAA: 35.98%; TA: 0.39%
Tropical Japonica  504 3.80% 35.90% 0.00% 0.00% TAA: 59.72%; TA: 0.40%; TAAAA: 0.20%
Japonica Intermediate  241 14.10% 15.80% 0.00% 0.00% TAA: 68.88%; TA: 1.24%
VI/Aromatic  96 16.70% 4.20% 0.00% 0.00% TAA: 79.17%
Intermediate  90 17.80% 53.30% 3.33% 0.00% TAA: 25.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0610116533 TAAA -> TAAAA LOC_Os06g17440.1 upstream_gene_variant ; 4338.0bp to feature; MODIFIER silent_mutation Average:67.504; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0610116533 TAAA -> TAAAA LOC_Os06g17430-LOC_Os06g17440 intergenic_region ; MODIFIER silent_mutation Average:67.504; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0610116533 TAAA -> AAAA LOC_Os06g17440.1 upstream_gene_variant ; 4342.0bp to feature; MODIFIER silent_mutation Average:67.504; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0610116533 TAAA -> AAAA LOC_Os06g17430-LOC_Os06g17440 intergenic_region ; MODIFIER silent_mutation Average:67.504; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0610116533 TAAA -> T LOC_Os06g17440.1 upstream_gene_variant ; 4341.0bp to feature; MODIFIER silent_mutation Average:67.504; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0610116533 TAAA -> T LOC_Os06g17430-LOC_Os06g17440 intergenic_region ; MODIFIER silent_mutation Average:67.504; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0610116533 TAAA -> TAA LOC_Os06g17440.1 upstream_gene_variant ; 4339.0bp to feature; MODIFIER silent_mutation Average:67.504; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0610116533 TAAA -> TAA LOC_Os06g17430-LOC_Os06g17440 intergenic_region ; MODIFIER silent_mutation Average:67.504; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0610116533 TAAA -> TA LOC_Os06g17440.1 upstream_gene_variant ; 4340.0bp to feature; MODIFIER silent_mutation Average:67.504; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0610116533 TAAA -> TA LOC_Os06g17430-LOC_Os06g17440 intergenic_region ; MODIFIER silent_mutation Average:67.504; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0610116533 NA 3.83E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 5.99E-13 NA mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 1.38E-10 2.36E-14 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 1.35E-07 1.35E-07 mr1068 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 2.69E-07 NA mr1078 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 2.16E-06 1.29E-07 mr1078 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 4.51E-08 NA mr1087 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 3.32E-06 1.15E-07 mr1087 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 NA 9.11E-07 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 7.70E-14 NA mr1090 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 6.77E-12 7.54E-20 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 1.50E-08 1.04E-11 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 5.76E-08 NA mr1094 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 NA 5.33E-07 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 6.34E-08 1.18E-09 mr1094 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 7.35E-10 NA mr1096 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 9.38E-07 4.47E-08 mr1096 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 8.33E-08 1.63E-09 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 1.41E-09 NA mr1111 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 8.81E-08 1.45E-07 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 NA 3.64E-07 mr1111 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 2.96E-09 NA mr1121 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 1.56E-07 8.40E-10 mr1121 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 2.40E-06 7.97E-10 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 7.75E-10 NA mr1144 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 4.22E-09 3.37E-09 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 4.73E-06 4.73E-06 mr1144 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 1.10E-10 NA mr1211 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 1.01E-08 1.38E-13 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 4.63E-07 1.20E-08 mr1211 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 NA 9.67E-06 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 2.48E-08 NA mr1065_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 1.34E-09 NA mr1065_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 1.19E-17 NA mr1068_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 3.51E-16 2.89E-15 mr1068_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 2.24E-09 1.03E-10 mr1068_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 1.08E-10 NA mr1078_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 1.44E-11 1.14E-09 mr1078_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 5.65E-13 NA mr1087_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 4.15E-12 3.43E-09 mr1087_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 4.75E-07 NA mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 1.40E-20 NA mr1090_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 6.95E-20 1.14E-25 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 7.35E-14 1.14E-16 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 1.14E-08 NA mr1091_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 6.84E-09 NA mr1091_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 4.89E-12 NA mr1094_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 1.55E-08 2.93E-10 mr1094_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 4.89E-08 9.89E-10 mr1094_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 7.72E-15 NA mr1096_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 3.94E-11 5.81E-11 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 2.03E-08 4.99E-10 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 3.91E-08 NA mr1108_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 1.13E-08 NA mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 1.05E-08 NA mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 3.20E-07 2.47E-07 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 NA 1.77E-06 mr1110_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 1.88E-15 NA mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 2.82E-15 3.42E-11 mr1111_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 1.65E-07 1.65E-07 mr1111_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 1.34E-09 NA mr1112_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 1.79E-08 NA mr1112_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 NA 2.07E-06 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 5.48E-15 NA mr1121_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 1.36E-13 5.46E-14 mr1121_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 8.20E-06 2.42E-08 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 1.46E-14 NA mr1144_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 2.14E-15 2.33E-12 mr1144_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 NA 1.38E-06 mr1144_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 2.42E-12 NA mr1200_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 7.78E-13 2.35E-09 mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 1.47E-20 NA mr1211_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 2.59E-17 2.58E-21 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 8.71E-09 1.91E-11 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 4.73E-10 NA mr1234_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 4.31E-08 NA mr1234_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 3.09E-10 6.79E-11 mr1244_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 2.34E-07 NA mr1526_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 1.36E-08 NA mr1526_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0610116533 NA 1.37E-06 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251