\
| Variant ID: vg0609832495 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 9832495 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 236. )
ACCTTTCCTCCAGCATCTCTCGCAGGTATTGCTTCCTTGCACCGTCTAAGTATCTTGACACAATCATCATCACCAAAACAATGCAAGACATACTGAAACA[T/C]
AAATATTTAGAAGTATAAAATAAAAGAAGTTTGGAGGCTAACTAGATAGCTAACTTGAAGGGAAAATGCATCTCTAAAACCCTCGAACTATTATAAATTG
CAATTTATAATAGTTCGAGGGTTTTAGAGATGCATTTTCCCTTCAAGTTAGCTATCTAGTTAGCCTCCAAACTTCTTTTATTTTATACTTCTAAATATTT[A/G]
TGTTTCAGTATGTCTTGCATTGTTTTGGTGATGATGATTGTGTCAAGATACTTAGACGGTGCAAGGAAGCAATACCTGCGAGAGATGCTGGAGGAAAGGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 96.20% | 3.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 92.60% | 7.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0609832495 | T -> C | LOC_Os06g16960.1 | intron_variant ; MODIFIER | silent_mutation | Average:35.155; most accessible tissue: Zhenshan97 young leaf, score: 59.612 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0609832495 | NA | 7.87E-07 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609832495 | NA | 4.51E-07 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609832495 | NA | 3.33E-10 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609832495 | NA | 1.42E-06 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609832495 | 6.26E-08 | 3.34E-10 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609832495 | NA | 1.28E-07 | mr1409_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609832495 | NA | 8.99E-07 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609832495 | 3.40E-09 | 9.59E-13 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609832495 | 1.49E-06 | 1.49E-06 | mr1647_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609832495 | 9.99E-06 | 9.99E-06 | mr1657_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609832495 | NA | 2.11E-06 | mr1703_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609832495 | NA | 4.28E-07 | mr1765_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |