Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609830369:

Variant ID: vg0609830369 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 9830369
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

TTGTGGTGACGTCAGGCGAATGGCGCTGGAAGTGGCCTGTTGAACTAGACTCGACAACGATGGCGATGGAGCTGTGATTTTTGTCAGCGGGCAAGCAGCA[C/G]
TGGGGATGATGTCACTGAGGAAGAAGTGAGATGGGAGGAAAGCGTCGCTACGTCTAACGAGCACGGAGGTTCCAATGAAGCCATTGGACATGTATTGGGA

Reverse complement sequence

TCCCAATACATGTCCAATGGCTTCATTGGAACCTCCGTGCTCGTTAGACGTAGCGACGCTTTCCTCCCATCTCACTTCTTCCTCAGTGACATCATCCCCA[G/C]
TGCTGCTTGCCCGCTGACAAAAATCACAGCTCCATCGCCATCGTTGTCGAGTCTAGTTCAACAGGCCACTTCCAGCGCCATTCGCCTGACGTCACCACAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.60%	33.30%	0.15%	0.00%	NA
All Indica	2759	85.30%	14.60%	0.07%	0.00%	NA
All Japonica	1512	45.50%	54.20%	0.26%	0.00%	NA
Aus	269	15.60%	84.40%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	83.20%	16.80%	0.00%	0.00%	NA
Indica III	913	80.60%	19.40%	0.00%	0.00%	NA
Indica Intermediate	786	81.20%	18.60%	0.25%	0.00%	NA
Temperate Japonica	767	57.90%	42.00%	0.13%	0.00%	NA
Tropical Japonica	504	37.10%	62.50%	0.40%	0.00%	NA
Japonica Intermediate	241	23.70%	75.90%	0.41%	0.00%	NA
VI/Aromatic	96	7.30%	92.70%	0.00%	0.00%	NA
Intermediate	90	62.20%	36.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0609830369	C -> G	LOC_Os06g16960.1	downstream_gene_variant ; 1818.0bp to feature; MODIFIER	silent_mutation	Average:46.653; most accessible tissue: Zhenshan97 young leaf, score: 77.101	N	N	N	N
vg0609830369	C -> G	LOC_Os06g16950-LOC_Os06g16960	intergenic_region ; MODIFIER	silent_mutation	Average:46.653; most accessible tissue: Zhenshan97 young leaf, score: 77.101	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0609830369	NA	4.27E-06	mr1059	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609830369	NA	2.61E-09	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609830369	NA	1.69E-06	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609830369	NA	5.89E-06	mr1167	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609830369	1.20E-06	4.41E-10	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609830369	NA	4.23E-06	mr1535	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609830369	NA	9.09E-06	mr1661	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609830369	NA	6.23E-06	mr1969	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609830369	NA	6.00E-06	mr1004_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609830369	1.83E-06	1.42E-08	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609830369	NA	4.85E-06	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609830369	1.18E-06	8.99E-10	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609830369	6.78E-10	NA	mr1571_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609830369	4.13E-07	4.13E-07	mr1571_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251