\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609830369:

Variant ID: vg0609830369 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 9830369
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTGGTGACGTCAGGCGAATGGCGCTGGAAGTGGCCTGTTGAACTAGACTCGACAACGATGGCGATGGAGCTGTGATTTTTGTCAGCGGGCAAGCAGCA[C/G]
TGGGGATGATGTCACTGAGGAAGAAGTGAGATGGGAGGAAAGCGTCGCTACGTCTAACGAGCACGGAGGTTCCAATGAAGCCATTGGACATGTATTGGGA

Reverse complement sequence

TCCCAATACATGTCCAATGGCTTCATTGGAACCTCCGTGCTCGTTAGACGTAGCGACGCTTTCCTCCCATCTCACTTCTTCCTCAGTGACATCATCCCCA[G/C]
TGCTGCTTGCCCGCTGACAAAAATCACAGCTCCATCGCCATCGTTGTCGAGTCTAGTTCAACAGGCCACTTCCAGCGCCATTCGCCTGACGTCACCACAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.60% 33.30% 0.15% 0.00% NA
All Indica  2759 85.30% 14.60% 0.07% 0.00% NA
All Japonica  1512 45.50% 54.20% 0.26% 0.00% NA
Aus  269 15.60% 84.40% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 83.20% 16.80% 0.00% 0.00% NA
Indica III  913 80.60% 19.40% 0.00% 0.00% NA
Indica Intermediate  786 81.20% 18.60% 0.25% 0.00% NA
Temperate Japonica  767 57.90% 42.00% 0.13% 0.00% NA
Tropical Japonica  504 37.10% 62.50% 0.40% 0.00% NA
Japonica Intermediate  241 23.70% 75.90% 0.41% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 62.20% 36.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0609830369 C -> G LOC_Os06g16960.1 downstream_gene_variant ; 1818.0bp to feature; MODIFIER silent_mutation Average:46.653; most accessible tissue: Zhenshan97 young leaf, score: 77.101 N N N N
vg0609830369 C -> G LOC_Os06g16950-LOC_Os06g16960 intergenic_region ; MODIFIER silent_mutation Average:46.653; most accessible tissue: Zhenshan97 young leaf, score: 77.101 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0609830369 NA 4.27E-06 mr1059 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609830369 NA 2.61E-09 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609830369 NA 1.69E-06 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609830369 NA 5.89E-06 mr1167 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609830369 1.20E-06 4.41E-10 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609830369 NA 4.23E-06 mr1535 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609830369 NA 9.09E-06 mr1661 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609830369 NA 6.23E-06 mr1969 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609830369 NA 6.00E-06 mr1004_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609830369 1.83E-06 1.42E-08 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609830369 NA 4.85E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609830369 1.18E-06 8.99E-10 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609830369 6.78E-10 NA mr1571_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609830369 4.13E-07 4.13E-07 mr1571_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251