| Variant ID: vg0609747066 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 9747066 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, others allele: 0.00, population size: 68. )
ATGTGATACCCTATGAAATTAATAAGTGACTATAATGTAAGCAGCAGGAGCAGCAAGAGATGAGAATTAGTGAACGGAAGTAATACGCGAGCAGCAATGG[C/T]
GATTGAATTATAACTGAAAACAATCAGGGAGAAGTTAGAAGTTGTTATAACTGAAAACAATTACTAAATTGCCCATCCTTATGTTATTTCTATTCCTAGA
TCTAGGAATAGAAATAACATAAGGATGGGCAATTTAGTAATTGTTTTCAGTTATAACAACTTCTAACTTCTCCCTGATTGTTTTCAGTTATAATTCAATC[G/A]
CCATTGCTGCTCGCGTATTACTTCCGTTCACTAATTCTCATCTCTTGCTGCTCCTGCTGCTTACATTATAGTCACTTATTAATTTCATAGGGTATCACAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.60% | 5.50% | 6.83% | 9.04% | NA |
| All Indica | 2759 | 85.10% | 4.30% | 9.79% | 0.87% | NA |
| All Japonica | 1512 | 62.80% | 9.00% | 2.71% | 25.46% | NA |
| Aus | 269 | 92.60% | 0.40% | 3.35% | 3.72% | NA |
| Indica I | 595 | 93.30% | 0.80% | 4.03% | 1.85% | NA |
| Indica II | 465 | 83.70% | 3.90% | 12.47% | 0.00% | NA |
| Indica III | 913 | 80.30% | 7.60% | 11.50% | 0.66% | NA |
| Indica Intermediate | 786 | 85.20% | 3.30% | 10.56% | 0.89% | NA |
| Temperate Japonica | 767 | 70.90% | 3.10% | 0.65% | 25.29% | NA |
| Tropical Japonica | 504 | 66.70% | 12.10% | 5.16% | 16.07% | NA |
| Japonica Intermediate | 241 | 29.00% | 21.20% | 4.15% | 45.64% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 1.04% | 3.12% | NA |
| Intermediate | 90 | 84.40% | 7.80% | 2.22% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0609747066 | C -> T | LOC_Os06g16840.1 | upstream_gene_variant ; 3096.0bp to feature; MODIFIER | silent_mutation | Average:53.437; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| vg0609747066 | C -> T | LOC_Os06g16820.1 | downstream_gene_variant ; 3188.0bp to feature; MODIFIER | silent_mutation | Average:53.437; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| vg0609747066 | C -> T | LOC_Os06g16830.1 | downstream_gene_variant ; 1871.0bp to feature; MODIFIER | silent_mutation | Average:53.437; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| vg0609747066 | C -> T | LOC_Os06g16830-LOC_Os06g16840 | intergenic_region ; MODIFIER | silent_mutation | Average:53.437; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| vg0609747066 | C -> DEL | N | N | silent_mutation | Average:53.437; most accessible tissue: Minghui63 flag leaf, score: 78.782 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0609747066 | NA | 6.29E-06 | Awn_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0609747066 | NA | 6.22E-06 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609747066 | NA | 2.68E-06 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609747066 | NA | 7.61E-06 | mr1117 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609747066 | NA | 1.14E-06 | mr1119 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609747066 | 3.11E-06 | 1.52E-08 | mr1247 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0609747066 | NA | 2.81E-09 | mr1161_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |