Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0609313418:

Variant ID: vg0609313418 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 9313418
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


CATACTATCGACCCCACCCAGTGTCGTCCATCCGCACAGCTCATACGTTGCCGCCTCTCCGCCCTCCCATCTCCGCTTCCCACTACTACCCTGGCCTTCC[C/T]
TCTAAACCCTCCCTCACCATCCCCTACCCCCTCCTACCTCCTCCTAAACCCGAAAACCTAATCTGGCGGTCCTTGACAGAGATACAACATGTCGCCATTA

Reverse complement sequence

TAATGGCGACATGTTGTATCTCTGTCAAGGACCGCCAGATTAGGTTTTCGGGTTTAGGAGGAGGTAGGAGGGGGTAGGGGATGGTGAGGGAGGGTTTAGA[G/A]
GGAAGGCCAGGGTAGTAGTGGGAAGCGGAGATGGGAGGGCGGAGAGGCGGCAACGTATGAGCTGTGCGGATGGACGACACTGGGTGGGGTCGATAGTATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.30% 17.00% 0.72% 0.00% NA
All Indica  2759 91.00% 8.60% 0.43% 0.00% NA
All Japonica  1512 63.90% 34.70% 1.39% 0.00% NA
Aus  269 94.10% 5.90% 0.00% 0.00% NA
Indica I  595 96.50% 3.00% 0.50% 0.00% NA
Indica II  465 84.10% 14.80% 1.08% 0.00% NA
Indica III  913 93.60% 6.20% 0.11% 0.00% NA
Indica Intermediate  786 87.80% 11.80% 0.38% 0.00% NA
Temperate Japonica  767 89.30% 9.40% 1.30% 0.00% NA
Tropical Japonica  504 18.30% 80.20% 1.59% 0.00% NA
Japonica Intermediate  241 78.40% 20.30% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 72.20% 26.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0609313418 C -> T LOC_Os06g16330.1 upstream_gene_variant ; 2573.0bp to feature; MODIFIER silent_mutation Average:66.472; most accessible tissue: Zhenshan97 young leaf, score: 80.589 N N N N
vg0609313418 C -> T LOC_Os06g16320-LOC_Os06g16330 intergenic_region ; MODIFIER silent_mutation Average:66.472; most accessible tissue: Zhenshan97 young leaf, score: 80.589 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0609313418 NA 7.87E-08 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 7.81E-07 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 7.67E-06 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 1.93E-07 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 7.84E-07 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 2.70E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 4.34E-09 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 2.04E-08 mr1642 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 1.07E-18 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 2.85E-07 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 5.30E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 8.09E-11 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 3.22E-10 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 4.04E-07 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 7.17E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 3.68E-07 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 4.59E-08 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 2.69E-09 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 3.14E-06 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 4.99E-06 mr1425_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 2.72E-07 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 5.22E-11 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 1.12E-15 mr1540_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 7.63E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 3.80E-07 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 6.83E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 9.06E-22 mr1699_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 1.26E-13 mr1732_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 1.71E-07 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 1.37E-11 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 9.62E-07 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609313418 NA 8.00E-12 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251