Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0609215665:

Variant ID: vg0609215665 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 9215665
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCTCCTCCTAGGGGGTCTTGTATTATACCCATAGGTGTCCCCTTGTCCAAGTAGAACTAGGGAGACCAATATGGATACAAGTCCTTGTCGTTTCCATGT[A/T]
GAATTCTATTCATCCTTCCTTATGCGAAACTCCTTCTATATACGAAGGTTGTATTCGTATAAAACATAGTATGTGGTGGGTCCTGCCGAGATTTAGTCAA

Reverse complement sequence

TTGACTAAATCTCGGCAGGACCCACCACATACTATGTTTTATACGAATACAACCTTCGTATATAGAAGGAGTTTCGCATAAGGAAGGATGAATAGAATTC[T/A]
ACATGGAAACGACAAGGACTTGTATCCATATTGGTCTCCCTAGTTCTACTTGGACAAGGGGACACCTATGGGTATAATACAAGACCCCCTAGGAGGAGAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.20%	7.20%	1.57%	43.02%	NA
All Indica	2759	26.40%	0.30%	1.20%	72.16%	NA
All Japonica	1512	74.90%	21.60%	2.71%	0.73%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	9.70%	0.20%	2.69%	87.39%	NA
Indica II	465	20.40%	0.40%	0.86%	78.28%	NA
Indica III	913	36.50%	0.00%	0.77%	62.76%	NA
Indica Intermediate	786	30.70%	0.60%	0.76%	67.94%	NA
Temperate Japonica	767	53.20%	40.80%	5.22%	0.78%	NA
Tropical Japonica	504	99.40%	0.00%	0.00%	0.60%	NA
Japonica Intermediate	241	92.90%	5.80%	0.41%	0.83%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	58.90%	7.80%	0.00%	33.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0609215665	A -> T	LOC_Os06g16180.1	upstream_gene_variant ; 68.0bp to feature; MODIFIER	silent_mutation	Average:27.837; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0609215665	A -> T	LOC_Os06g16190.1	upstream_gene_variant ; 3995.0bp to feature; MODIFIER	silent_mutation	Average:27.837; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0609215665	A -> T	LOC_Os06g16180-LOC_Os06g16190	intergenic_region ; MODIFIER	silent_mutation	Average:27.837; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N
vg0609215665	A -> DEL	N	N	silent_mutation	Average:27.837; most accessible tissue: Zhenshan97 panicle, score: 54.901	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0609215665	NA	1.96E-09	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609215665	NA	2.67E-09	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609215665	NA	3.53E-12	mr1712	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609215665	NA	1.69E-08	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609215665	9.74E-09	1.37E-38	mr1137_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609215665	NA	4.19E-14	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609215665	NA	5.31E-10	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609215665	NA	5.83E-08	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609215665	NA	2.06E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609215665	NA	4.01E-09	mr1570_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609215665	1.96E-07	2.60E-27	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609215665	NA	1.10E-10	mr1617_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609215665	NA	4.79E-06	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609215665	NA	2.05E-08	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609215665	NA	9.07E-10	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0609215665	NA	2.51E-07	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251