\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608700390:

Variant ID: vg0608700390 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 8700390
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGAAAAAATAGATGAAAGGTGGTTTCTCTTGCACAGGTTGAGCAAAGGACACAAGTTAGATCTGAATTATTGGGAGGGCAATGCCTTCTGTCAAGCATG[T/C]
CATAAGTATTGAGTCGGAAGCCATCCAAAAACTTTAACCTTCATAGCGCACTTACTCTTCCAGATCCAAGCTAGATAACTAGGCGCATGTATATGCATGA

Reverse complement sequence

TCATGCATATACATGCGCCTAGTTATCTAGCTTGGATCTGGAAGAGTAAGTGCGCTATGAAGGTTAAAGTTTTTGGATGGCTTCCGACTCAATACTTATG[A/G]
CATGCTTGACAGAAGGCATTGCCCTCCCAATAATTCAGATCTAACTTGTGTCCTTTGCTCAACCTGTGCAAGAGAAACCACCTTTCATCTATTTTTTCAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.50% 9.60% 6.71% 40.12% NA
All Indica  2759 22.60% 1.40% 9.35% 66.62% NA
All Japonica  1512 71.00% 26.30% 1.92% 0.73% NA
Aus  269 84.00% 0.70% 7.81% 7.43% NA
Indica I  595 17.10% 0.20% 9.08% 73.61% NA
Indica II  465 23.20% 2.40% 7.53% 66.88% NA
Indica III  913 25.20% 1.20% 10.95% 62.65% NA
Indica Intermediate  786 23.40% 2.00% 8.78% 65.78% NA
Temperate Japonica  767 93.40% 4.70% 1.17% 0.78% NA
Tropical Japonica  504 32.10% 64.30% 3.17% 0.40% NA
Japonica Intermediate  241 81.30% 15.80% 1.66% 1.24% NA
VI/Aromatic  96 97.90% 0.00% 2.08% 0.00% NA
Intermediate  90 43.30% 18.90% 7.78% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0608700390 T -> C LOC_Os06g15320.1 upstream_gene_variant ; 3739.0bp to feature; MODIFIER silent_mutation Average:5.168; most accessible tissue: Zhenshan97 young leaf, score: 7.417 N N N N
vg0608700390 T -> C LOC_Os06g15330.1 upstream_gene_variant ; 4441.0bp to feature; MODIFIER silent_mutation Average:5.168; most accessible tissue: Zhenshan97 young leaf, score: 7.417 N N N N
vg0608700390 T -> C LOC_Os06g15320-LOC_Os06g15330 intergenic_region ; MODIFIER silent_mutation Average:5.168; most accessible tissue: Zhenshan97 young leaf, score: 7.417 N N N N
vg0608700390 T -> DEL N N silent_mutation Average:5.168; most accessible tissue: Zhenshan97 young leaf, score: 7.417 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0608700390 NA 1.48E-10 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0608700390 NA 7.95E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608700390 1.64E-08 1.16E-28 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608700390 5.74E-06 2.37E-17 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608700390 NA 1.68E-08 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608700390 1.73E-07 4.43E-19 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608700390 NA 1.40E-14 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608700390 NA 9.75E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608700390 NA 5.10E-30 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608700390 NA 4.99E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608700390 NA 7.11E-10 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608700390 NA 1.96E-07 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608700390 NA 1.06E-07 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608700390 3.46E-14 9.78E-37 mr1301_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608700390 2.78E-06 2.31E-21 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608700390 NA 4.49E-09 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608700390 4.97E-10 2.56E-23 mr1410_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608700390 NA 7.79E-15 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608700390 NA 9.55E-13 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608700390 NA 8.06E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608700390 NA 1.47E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608700390 NA 2.39E-14 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608700390 NA 5.17E-14 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251