Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0608278039:

Variant ID: vg0608278039 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 8278039
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.59, C: 0.41, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

TCGCATATCACCACTATTTACTATTTATTTTCGTTGTATTATAAGTTATGTGCCTTTTTAATAGATGGAATTACATCCATACAAGAAAGCAAACTTAGTA[T/C]
GTCATTAATACAACAAAAATATCACCTCTACTTCATACCAAATTGTTCATGTCTCACTTGTGTTTAAATATATGTATAAATATTTTGAAGTATGTAACAT

Reverse complement sequence

ATGTTACATACTTCAAAATATTTATACATATATTTAAACACAAGTGAGACATGAACAATTTGGTATGAAGTAGAGGTGATATTTTTGTTGTATTAATGAC[A/G]
TACTAAGTTTGCTTTCTTGTATGGATGTAATTCCATCTATTAAAAAGGCACATAACTTATAATACAACGAAAATAAATAGTAAATAGTGGTGATATGCGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.40%	41.60%	1.04%	0.00%	NA
All Indica	2759	67.00%	32.70%	0.33%	0.00%	NA
All Japonica	1512	48.90%	48.90%	2.25%	0.00%	NA
Aus	269	7.10%	92.60%	0.37%	0.00%	NA
Indica I	595	58.80%	41.00%	0.17%	0.00%	NA
Indica II	465	93.80%	6.00%	0.22%	0.00%	NA
Indica III	913	51.60%	47.80%	0.66%	0.00%	NA
Indica Intermediate	786	75.20%	24.70%	0.13%	0.00%	NA
Temperate Japonica	767	24.30%	74.40%	1.30%	0.00%	NA
Tropical Japonica	504	74.60%	21.60%	3.77%	0.00%	NA
Japonica Intermediate	241	73.40%	24.50%	2.07%	0.00%	NA
VI/Aromatic	96	47.90%	51.00%	1.04%	0.00%	NA
Intermediate	90	65.60%	30.00%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0608278039	T -> C	LOC_Os06g14710.1	upstream_gene_variant ; 4988.0bp to feature; MODIFIER	silent_mutation	Average:24.952; most accessible tissue: Callus, score: 57.052	N	N	N	N
vg0608278039	T -> C	LOC_Os06g14700.1	downstream_gene_variant ; 4820.0bp to feature; MODIFIER	silent_mutation	Average:24.952; most accessible tissue: Callus, score: 57.052	N	N	N	N
vg0608278039	T -> C	LOC_Os06g14700-LOC_Os06g14710	intergenic_region ; MODIFIER	silent_mutation	Average:24.952; most accessible tissue: Callus, score: 57.052	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0608278039	NA	2.41E-09	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608278039	NA	1.17E-08	mr1328	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608278039	NA	1.32E-10	mr1446	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608278039	NA	8.75E-08	mr1570	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608278039	NA	3.32E-08	mr1989	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608278039	1.45E-06	5.62E-10	mr1570_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608278039	NA	4.98E-07	mr1668_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251