| Variant ID: vg0608278039 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 8278039 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.59, C: 0.41, others allele: 0.00, population size: 103. )
TCGCATATCACCACTATTTACTATTTATTTTCGTTGTATTATAAGTTATGTGCCTTTTTAATAGATGGAATTACATCCATACAAGAAAGCAAACTTAGTA[T/C]
GTCATTAATACAACAAAAATATCACCTCTACTTCATACCAAATTGTTCATGTCTCACTTGTGTTTAAATATATGTATAAATATTTTGAAGTATGTAACAT
ATGTTACATACTTCAAAATATTTATACATATATTTAAACACAAGTGAGACATGAACAATTTGGTATGAAGTAGAGGTGATATTTTTGTTGTATTAATGAC[A/G]
TACTAAGTTTGCTTTCTTGTATGGATGTAATTCCATCTATTAAAAAGGCACATAACTTATAATACAACGAAAATAAATAGTAAATAGTGGTGATATGCGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.40% | 41.60% | 1.04% | 0.00% | NA |
| All Indica | 2759 | 67.00% | 32.70% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 48.90% | 48.90% | 2.25% | 0.00% | NA |
| Aus | 269 | 7.10% | 92.60% | 0.37% | 0.00% | NA |
| Indica I | 595 | 58.80% | 41.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 93.80% | 6.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 51.60% | 47.80% | 0.66% | 0.00% | NA |
| Indica Intermediate | 786 | 75.20% | 24.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 24.30% | 74.40% | 1.30% | 0.00% | NA |
| Tropical Japonica | 504 | 74.60% | 21.60% | 3.77% | 0.00% | NA |
| Japonica Intermediate | 241 | 73.40% | 24.50% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 47.90% | 51.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 30.00% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0608278039 | T -> C | LOC_Os06g14710.1 | upstream_gene_variant ; 4988.0bp to feature; MODIFIER | silent_mutation | Average:24.952; most accessible tissue: Callus, score: 57.052 | N | N | N | N |
| vg0608278039 | T -> C | LOC_Os06g14700.1 | downstream_gene_variant ; 4820.0bp to feature; MODIFIER | silent_mutation | Average:24.952; most accessible tissue: Callus, score: 57.052 | N | N | N | N |
| vg0608278039 | T -> C | LOC_Os06g14700-LOC_Os06g14710 | intergenic_region ; MODIFIER | silent_mutation | Average:24.952; most accessible tissue: Callus, score: 57.052 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0608278039 | NA | 2.41E-09 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608278039 | NA | 1.17E-08 | mr1328 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608278039 | NA | 1.32E-10 | mr1446 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608278039 | NA | 8.75E-08 | mr1570 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608278039 | NA | 3.32E-08 | mr1989 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608278039 | 1.45E-06 | 5.62E-10 | mr1570_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608278039 | NA | 4.98E-07 | mr1668_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |