\
| Variant ID: vg0608277816 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 8277816 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.50, C: 0.48, G: 0.02, others allele: 0.00, population size: 94. )
TAAGAACAGCTTATTTATTATTTATAAAAATAATGCTAAATTATTTATAAAAATAATGCTAAAGAAATCCTATCTCGCTATATTAATTAATTATAAGGAC[A/C]
GTATAGATCGCCTTATAATTATATAAAAAATAAATATCTAGACCATAAATTTTGATATACCAAATGACAATAGTATCTTTCATATTCAAACAGAAATAAC
GTTATTTCTGTTTGAATATGAAAGATACTATTGTCATTTGGTATATCAAAATTTATGGTCTAGATATTTATTTTTTATATAATTATAAGGCGATCTATAC[T/G]
GTCCTTATAATTAATTAATATAGCGAGATAGGATTTCTTTAGCATTATTTTTATAAATAATTTAGCATTATTTTTATAAATAATAAATAAGCTGTTCTTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.20% | 38.50% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 67.20% | 32.50% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 59.70% | 40.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 7.40% | 92.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 58.30% | 41.20% | 0.50% | 0.00% | NA |
| Indica II | 465 | 93.80% | 5.80% | 0.43% | 0.00% | NA |
| Indica III | 913 | 51.70% | 47.90% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 76.10% | 23.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 28.30% | 71.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.40% | 21.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 49.00% | 51.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 17.80% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0608277816 | A -> C | LOC_Os06g14700.1 | downstream_gene_variant ; 4597.0bp to feature; MODIFIER | silent_mutation | Average:26.047; most accessible tissue: Callus, score: 61.209 | N | N | N | N |
| vg0608277816 | A -> C | LOC_Os06g14700-LOC_Os06g14710 | intergenic_region ; MODIFIER | silent_mutation | Average:26.047; most accessible tissue: Callus, score: 61.209 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0608277816 | NA | 3.86E-10 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608277816 | NA | 7.52E-11 | mr1328 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608277816 | NA | 2.19E-12 | mr1446 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608277816 | NA | 8.75E-08 | mr1570 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608277816 | NA | 1.17E-08 | mr1989 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608277816 | 1.45E-06 | 5.62E-10 | mr1570_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0608277816 | NA | 4.98E-07 | mr1668_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |