\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608277816:

Variant ID: vg0608277816 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 8277816
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.50, C: 0.48, G: 0.02, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TAAGAACAGCTTATTTATTATTTATAAAAATAATGCTAAATTATTTATAAAAATAATGCTAAAGAAATCCTATCTCGCTATATTAATTAATTATAAGGAC[A/C]
GTATAGATCGCCTTATAATTATATAAAAAATAAATATCTAGACCATAAATTTTGATATACCAAATGACAATAGTATCTTTCATATTCAAACAGAAATAAC

Reverse complement sequence

GTTATTTCTGTTTGAATATGAAAGATACTATTGTCATTTGGTATATCAAAATTTATGGTCTAGATATTTATTTTTTATATAATTATAAGGCGATCTATAC[T/G]
GTCCTTATAATTAATTAATATAGCGAGATAGGATTTCTTTAGCATTATTTTTATAAATAATTTAGCATTATTTTTATAAATAATAAATAAGCTGTTCTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.20% 38.50% 0.28% 0.00% NA
All Indica  2759 67.20% 32.50% 0.36% 0.00% NA
All Japonica  1512 59.70% 40.30% 0.07% 0.00% NA
Aus  269 7.40% 92.60% 0.00% 0.00% NA
Indica I  595 58.30% 41.20% 0.50% 0.00% NA
Indica II  465 93.80% 5.80% 0.43% 0.00% NA
Indica III  913 51.70% 47.90% 0.44% 0.00% NA
Indica Intermediate  786 76.10% 23.80% 0.13% 0.00% NA
Temperate Japonica  767 28.30% 71.70% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.40% 0.20% 0.00% NA
Japonica Intermediate  241 78.40% 21.60% 0.00% 0.00% NA
VI/Aromatic  96 49.00% 51.00% 0.00% 0.00% NA
Intermediate  90 80.00% 17.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0608277816 A -> C LOC_Os06g14700.1 downstream_gene_variant ; 4597.0bp to feature; MODIFIER silent_mutation Average:26.047; most accessible tissue: Callus, score: 61.209 N N N N
vg0608277816 A -> C LOC_Os06g14700-LOC_Os06g14710 intergenic_region ; MODIFIER silent_mutation Average:26.047; most accessible tissue: Callus, score: 61.209 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0608277816 NA 3.86E-10 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608277816 NA 7.52E-11 mr1328 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608277816 NA 2.19E-12 mr1446 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608277816 NA 8.75E-08 mr1570 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608277816 NA 1.17E-08 mr1989 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608277816 1.45E-06 5.62E-10 mr1570_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608277816 NA 4.98E-07 mr1668_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251