\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608245933:

Variant ID: vg0608245933 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 8245933
Reference Allele: CAlternative Allele: T,CCGATT
Primary Allele: CSecondary Allele: CCGATT

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


GACGGATTAAATAGGCTTAATAAATTCGTCTCGCGGTTTCCAGGCGAGTTATGAAATTAATTTTTTCATTCGTATCCGAAAACCCCTTCCGACATCCGAT[C/T,CCGATT]
AAACGTCTGATGTGACACCCAAATTTTTTTTTTCACGAACTAAACACACCCTAACACCAAATAGTTCAAGAAAGCGGAGACTATGGTTAACATAATTCAA

Reverse complement sequence

TTGAATTATGTTAACCATAGTCTCCGCTTTCTTGAACTATTTGGTGTTAGGGTGTGTTTAGTTCGTGAAAAAAAAAATTTGGGTGTCACATCAGACGTTT[G/A,AATCGG]
ATCGGATGTCGGAAGGGGTTTTCGGATACGAATGAAAAAATTAATTTCATAACTCGCCTGGAAACCGCGAGACGAATTTATTAAGCCTATTTAATCCGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of CCGATT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.90% 5.20% 0.34% 0.00% T: 4.55%
All Indica  2759 99.40% 0.50% 0.04% 0.00% T: 0.04%
All Japonica  1512 85.90% 0.10% 0.26% 0.00% T: 13.76%
Aus  269 11.20% 82.90% 4.09% 0.00% T: 1.86%
Indica I  595 99.80% 0.00% 0.00% 0.00% T: 0.17%
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.10% 1.80% 0.13% 0.00% NA
Temperate Japonica  767 76.50% 0.00% 0.39% 0.00% T: 23.08%
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 86.70% 0.40% 0.00% 0.00% T: 12.86%
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 96.70% 2.20% 0.00% 0.00% T: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0608245933 C -> T LOC_Os06g14660.1 upstream_gene_variant ; 1180.0bp to feature; MODIFIER silent_mutation Average:61.489; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0608245933 C -> T LOC_Os06g14650.1 downstream_gene_variant ; 484.0bp to feature; MODIFIER silent_mutation Average:61.489; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0608245933 C -> T LOC_Os06g14650-LOC_Os06g14660 intergenic_region ; MODIFIER silent_mutation Average:61.489; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0608245933 C -> CCGATT LOC_Os06g14660.1 upstream_gene_variant ; 1179.0bp to feature; MODIFIER silent_mutation Average:61.489; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0608245933 C -> CCGATT LOC_Os06g14650.1 downstream_gene_variant ; 485.0bp to feature; MODIFIER silent_mutation Average:61.489; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0608245933 C -> CCGATT LOC_Os06g14650-LOC_Os06g14660 intergenic_region ; MODIFIER silent_mutation Average:61.489; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0608245933 NA 5.52E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933 NA 6.47E-06 mr1259 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933 NA 2.32E-14 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933 NA 5.65E-12 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933 NA 2.29E-13 mr1465 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933 NA 1.44E-11 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933 NA 3.34E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933 NA 2.53E-12 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933 NA 1.06E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933 3.70E-06 NA mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933 NA 3.04E-12 mr1510_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933 NA 3.38E-20 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933 NA 9.93E-09 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933 NA 5.72E-09 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933 NA 7.73E-09 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933 NA 4.26E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933 NA 1.57E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933 NA 6.42E-06 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933 NA 1.28E-18 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933 NA 2.45E-09 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933 7.83E-06 7.83E-06 mr1967_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251