Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608245933:

Variant ID: vg0608245933 (JBrowse)	Variation Type: INDEL
Chromosome: chr06	Position: 8245933
Reference Allele: C	Alternative Allele: T,CCGATT
Primary Allele: C	Secondary Allele: CCGATT

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

GACGGATTAAATAGGCTTAATAAATTCGTCTCGCGGTTTCCAGGCGAGTTATGAAATTAATTTTTTCATTCGTATCCGAAAACCCCTTCCGACATCCGAT[C/T,CCGATT]
AAACGTCTGATGTGACACCCAAATTTTTTTTTTCACGAACTAAACACACCCTAACACCAAATAGTTCAAGAAAGCGGAGACTATGGTTAACATAATTCAA

Reverse complement sequence

TTGAATTATGTTAACCATAGTCTCCGCTTTCTTGAACTATTTGGTGTTAGGGTGTGTTTAGTTCGTGAAAAAAAAAATTTGGGTGTCACATCAGACGTTT[G/A,AATCGG]
ATCGGATGTCGGAAGGGGTTTTCGGATACGAATGAAAAAATTAATTTCATAACTCGCCTGGAAACCGCGAGACGAATTTATTAAGCCTATTTAATCCGTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of CCGATT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.90%	5.20%	0.34%	0.00%	T: 4.55%
All Indica	2759	99.40%	0.50%	0.04%	0.00%	T: 0.04%
All Japonica	1512	85.90%	0.10%	0.26%	0.00%	T: 13.76%
Aus	269	11.20%	82.90%	4.09%	0.00%	T: 1.86%
Indica I	595	99.80%	0.00%	0.00%	0.00%	T: 0.17%
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.10%	1.80%	0.13%	0.00%	NA
Temperate Japonica	767	76.50%	0.00%	0.39%	0.00%	T: 23.08%
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	86.70%	0.40%	0.00%	0.00%	T: 12.86%
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	96.70%	2.20%	0.00%	0.00%	T: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0608245933	C -> T	LOC_Os06g14660.1	upstream_gene_variant ; 1180.0bp to feature; MODIFIER	silent_mutation	Average:61.489; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0608245933	C -> T	LOC_Os06g14650.1	downstream_gene_variant ; 484.0bp to feature; MODIFIER	silent_mutation	Average:61.489; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0608245933	C -> T	LOC_Os06g14650-LOC_Os06g14660	intergenic_region ; MODIFIER	silent_mutation	Average:61.489; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0608245933	C -> CCGATT	LOC_Os06g14660.1	upstream_gene_variant ; 1179.0bp to feature; MODIFIER	silent_mutation	Average:61.489; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0608245933	C -> CCGATT	LOC_Os06g14650.1	downstream_gene_variant ; 485.0bp to feature; MODIFIER	silent_mutation	Average:61.489; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N
vg0608245933	C -> CCGATT	LOC_Os06g14650-LOC_Os06g14660	intergenic_region ; MODIFIER	silent_mutation	Average:61.489; most accessible tissue: Minghui63 panicle, score: 82.797	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0608245933	NA	5.52E-06	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933	NA	6.47E-06	mr1259	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933	NA	2.32E-14	mr1270	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933	NA	5.65E-12	mr1409	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933	NA	2.29E-13	mr1465	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933	NA	1.44E-11	mr1540	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933	NA	3.34E-06	mr1621	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933	NA	2.53E-12	mr1649	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933	NA	1.06E-07	mr1716	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933	3.70E-06	NA	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933	NA	3.04E-12	mr1510_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933	NA	3.38E-20	mr1531_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933	NA	9.93E-09	mr1582_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933	NA	5.72E-09	mr1702_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933	NA	7.73E-09	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933	NA	4.26E-06	mr1729_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933	NA	1.57E-06	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933	NA	6.42E-06	mr1743_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933	NA	1.28E-18	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933	NA	2.45E-09	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608245933	7.83E-06	7.83E-06	mr1967_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251