Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608164173:

Variant ID: vg0608164173 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 8164173
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTGGAGAGTCTAATTTGGAGATGCTCAAGATTACCGGACGGCCGGTGGACTCATCAACACATGAGTTGCACAAGCTACCCCCTCCCTCCCTCCCTCCCC[C/T]
CGGGAAAAAAAACTTATAAAAATATATCTATTCTCTATTGTTATAAAAATTAAAAATGTTTTTGTCGGTATTTTGGTTCGTCATCCGTGTATAAGTAGGT

Reverse complement sequence

ACCTACTTATACACGGATGACGAACCAAAATACCGACAAAAACATTTTTAATTTTTATAACAATAGAGAATAGATATATTTTTATAAGTTTTTTTTCCCG[G/A]
GGGGAGGGAGGGAGGGAGGGGGTAGCTTGTGCAACTCATGTGTTGATGAGTCCACCGGCCGTCCGGTAATCTTGAGCATCTCCAAATTAGACTCTCCAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.40%	11.10%	14.58%	9.92%	NA
All Indica	2759	59.40%	0.50%	23.63%	16.53%	NA
All Japonica	1512	83.70%	15.60%	0.46%	0.20%	NA
Aus	269	9.70%	83.30%	7.06%	0.00%	NA
Indica I	595	61.70%	0.20%	24.20%	13.95%	NA
Indica II	465	39.40%	0.00%	28.60%	32.04%	NA
Indica III	913	72.10%	0.10%	17.96%	9.86%	NA
Indica Intermediate	786	54.70%	1.40%	26.84%	17.05%	NA
Temperate Japonica	767	72.50%	26.30%	0.78%	0.39%	NA
Tropical Japonica	504	99.60%	0.20%	0.20%	0.00%	NA
Japonica Intermediate	241	86.30%	13.70%	0.00%	0.00%	NA
VI/Aromatic	96	52.10%	47.90%	0.00%	0.00%	NA
Intermediate	90	71.10%	5.60%	12.22%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0608164173	C -> T	LOC_Os06g14520.1	upstream_gene_variant ; 416.0bp to feature; MODIFIER	silent_mutation	Average:53.201; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0608164173	C -> T	LOC_Os06g14510.1	downstream_gene_variant ; 4788.0bp to feature; MODIFIER	silent_mutation	Average:53.201; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0608164173	C -> T	LOC_Os06g14510.3	downstream_gene_variant ; 4788.0bp to feature; MODIFIER	silent_mutation	Average:53.201; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0608164173	C -> T	LOC_Os06g14510.2	downstream_gene_variant ; 4788.0bp to feature; MODIFIER	silent_mutation	Average:53.201; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0608164173	C -> T	LOC_Os06g14520-LOC_Os06g14530	intergenic_region ; MODIFIER	silent_mutation	Average:53.201; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N
vg0608164173	C -> DEL	N	N	silent_mutation	Average:53.201; most accessible tissue: Zhenshan97 panicle, score: 73.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0608164173	NA	4.21E-16	mr1166	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173	NA	4.22E-14	mr1409	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173	NA	1.60E-06	mr1415	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173	NA	7.80E-13	mr1465	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173	NA	1.92E-18	mr1515	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173	NA	4.30E-12	mr1540	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173	NA	1.60E-06	mr1567	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173	NA	2.32E-24	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173	NA	6.62E-13	mr1649	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173	NA	7.41E-08	mr1669	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173	NA	2.90E-18	mr1765	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173	NA	7.26E-18	mr1260_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173	NA	7.48E-06	mr1344_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173	NA	2.00E-11	mr1409_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173	NA	1.47E-10	mr1510_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173	1.06E-07	1.16E-26	mr1531_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173	NA	3.69E-08	mr1582_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173	NA	6.52E-18	mr1583_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173	NA	3.80E-07	mr1702_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173	NA	9.84E-06	mr1702_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173	NA	4.31E-10	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173	9.93E-06	9.93E-06	mr1711_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173	NA	8.55E-07	mr1743_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173	NA	3.48E-19	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251