\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0608164173:

Variant ID: vg0608164173 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 8164173
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTGGAGAGTCTAATTTGGAGATGCTCAAGATTACCGGACGGCCGGTGGACTCATCAACACATGAGTTGCACAAGCTACCCCCTCCCTCCCTCCCTCCCC[C/T]
CGGGAAAAAAAACTTATAAAAATATATCTATTCTCTATTGTTATAAAAATTAAAAATGTTTTTGTCGGTATTTTGGTTCGTCATCCGTGTATAAGTAGGT

Reverse complement sequence

ACCTACTTATACACGGATGACGAACCAAAATACCGACAAAAACATTTTTAATTTTTATAACAATAGAGAATAGATATATTTTTATAAGTTTTTTTTCCCG[G/A]
GGGGAGGGAGGGAGGGAGGGGGTAGCTTGTGCAACTCATGTGTTGATGAGTCCACCGGCCGTCCGGTAATCTTGAGCATCTCCAAATTAGACTCTCCAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.40% 11.10% 14.58% 9.92% NA
All Indica  2759 59.40% 0.50% 23.63% 16.53% NA
All Japonica  1512 83.70% 15.60% 0.46% 0.20% NA
Aus  269 9.70% 83.30% 7.06% 0.00% NA
Indica I  595 61.70% 0.20% 24.20% 13.95% NA
Indica II  465 39.40% 0.00% 28.60% 32.04% NA
Indica III  913 72.10% 0.10% 17.96% 9.86% NA
Indica Intermediate  786 54.70% 1.40% 26.84% 17.05% NA
Temperate Japonica  767 72.50% 26.30% 0.78% 0.39% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 86.30% 13.70% 0.00% 0.00% NA
VI/Aromatic  96 52.10% 47.90% 0.00% 0.00% NA
Intermediate  90 71.10% 5.60% 12.22% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0608164173 C -> T LOC_Os06g14520.1 upstream_gene_variant ; 416.0bp to feature; MODIFIER silent_mutation Average:53.201; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0608164173 C -> T LOC_Os06g14510.1 downstream_gene_variant ; 4788.0bp to feature; MODIFIER silent_mutation Average:53.201; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0608164173 C -> T LOC_Os06g14510.3 downstream_gene_variant ; 4788.0bp to feature; MODIFIER silent_mutation Average:53.201; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0608164173 C -> T LOC_Os06g14510.2 downstream_gene_variant ; 4788.0bp to feature; MODIFIER silent_mutation Average:53.201; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0608164173 C -> T LOC_Os06g14520-LOC_Os06g14530 intergenic_region ; MODIFIER silent_mutation Average:53.201; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg0608164173 C -> DEL N N silent_mutation Average:53.201; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0608164173 NA 4.21E-16 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173 NA 4.22E-14 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173 NA 1.60E-06 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173 NA 7.80E-13 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173 NA 1.92E-18 mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173 NA 4.30E-12 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173 NA 1.60E-06 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173 NA 2.32E-24 mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173 NA 6.62E-13 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173 NA 7.41E-08 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173 NA 2.90E-18 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173 NA 7.26E-18 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173 NA 7.48E-06 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173 NA 2.00E-11 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173 NA 1.47E-10 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173 1.06E-07 1.16E-26 mr1531_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173 NA 3.69E-08 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173 NA 6.52E-18 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173 NA 3.80E-07 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173 NA 9.84E-06 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173 NA 4.31E-10 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173 9.93E-06 9.93E-06 mr1711_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173 NA 8.55E-07 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608164173 NA 3.48E-19 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251