Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0608160267:

Variant ID: vg0608160267 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 8160267
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGTTATTGAAGGCGGGGCTATATCATTGCACAGTGGAGTTGGATGAGATGGAAGTAATGGCAGCTAGGGATGAAAATGGTCGGAAACGATCGGAAAACAG[C/T]
CTCAACCATTTCCGTAACCATATTTTTCTCGGAAACGAAATCGGAAACGGTAAAGTCGGAAACGAAAACGATATCGGAAATATCGGAAAACCGGAAACGG

Reverse complement sequence

CCGTTTCCGGTTTTCCGATATTTCCGATATCGTTTTCGTTTCCGACTTTACCGTTTCCGATTTCGTTTCCGAGAAAAATATGGTTACGGAAATGGTTGAG[G/A]
CTGTTTTCCGATCGTTTCCGACCATTTTCATCCCTAGCTGCCATTACTTCCATCTCATCCAACTCCACTGTGCAATGATATAGCCCCGCCTTCAATAACG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.90%	5.00%	0.28%	23.85%	NA
All Indica	2759	98.40%	0.00%	0.00%	1.52%	NA
All Japonica	1512	20.40%	15.50%	0.66%	63.49%	NA
Aus	269	93.30%	0.00%	0.00%	6.69%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	97.40%	0.00%	0.00%	2.58%	NA
Indica III	913	98.40%	0.00%	0.00%	1.64%	NA
Indica Intermediate	786	98.10%	0.00%	0.00%	1.91%	NA
Temperate Japonica	767	33.40%	26.50%	0.13%	40.03%	NA
Tropical Japonica	504	4.80%	0.00%	1.39%	93.85%	NA
Japonica Intermediate	241	11.60%	12.90%	0.83%	74.69%	NA
VI/Aromatic	96	14.60%	0.00%	0.00%	85.42%	NA
Intermediate	90	67.80%	1.10%	3.33%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0608160267	C -> T	LOC_Os06g14510.1	downstream_gene_variant ; 882.0bp to feature; MODIFIER	silent_mutation	Average:60.6; most accessible tissue: Callus, score: 85.22	N	N	N	N
vg0608160267	C -> T	LOC_Os06g14520.1	downstream_gene_variant ; 3260.0bp to feature; MODIFIER	silent_mutation	Average:60.6; most accessible tissue: Callus, score: 85.22	N	N	N	N
vg0608160267	C -> T	LOC_Os06g14510.3	downstream_gene_variant ; 882.0bp to feature; MODIFIER	silent_mutation	Average:60.6; most accessible tissue: Callus, score: 85.22	N	N	N	N
vg0608160267	C -> T	LOC_Os06g14510.2	downstream_gene_variant ; 882.0bp to feature; MODIFIER	silent_mutation	Average:60.6; most accessible tissue: Callus, score: 85.22	N	N	N	N
vg0608160267	C -> T	LOC_Os06g14510-LOC_Os06g14520	intergenic_region ; MODIFIER	silent_mutation	Average:60.6; most accessible tissue: Callus, score: 85.22	N	N	N	N
vg0608160267	C -> DEL	N	N	silent_mutation	Average:60.6; most accessible tissue: Callus, score: 85.22	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0608160267	3.57E-06	NA	mr1295_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160267	NA	6.73E-06	mr1381_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160267	NA	8.53E-06	mr1707_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160267	7.36E-06	7.36E-06	mr1711_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160267	8.52E-06	8.52E-06	mr1743_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160267	7.23E-06	7.23E-06	mr1909_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0608160267	5.01E-06	5.01E-06	mr1967_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251