Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607995576:

Variant ID: vg0607995576 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7995576
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.69, C: 0.31, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


GCATCAACTACTGGGCTTGCCTCTTGCCCAAGCCACGGGCCTGAGGCCGTGACGCAGCCTCGGTGCTGGAGCGGCTGATGGGCTTTCTGCCCCACCGGAT[C/T]
GCAGGGCTCCAGCTAGCGCCTCACTCCCGACAGCTGCCCGGCAGGGGAAAATAAGTTCACTTTAGGTCCCTCAAATTTGTTGCTCAGTATGATTTTCGAA

Reverse complement sequence

TTCGAAAATCATACTGAGCAACAAATTTGAGGGACCTAAAGTGAACTTATTTTCCCCTGCCGGGCAGCTGTCGGGAGTGAGGCGCTAGCTGGAGCCCTGC[G/A]
ATCCGGTGGGGCAGAAAGCCCATCAGCCGCTCCAGCACCGAGGCTGCGTCACGGCCTCAGGCCCGTGGCTTGGGCAAGAGGCAAGCCCAGTAGTTGATGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.60% 43.30% 0.06% 0.00% NA
All Indica  2759 39.90% 60.10% 0.04% 0.00% NA
All Japonica  1512 79.30% 20.60% 0.07% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 60.80% 39.20% 0.00% 0.00% NA
Indica II  465 9.70% 90.30% 0.00% 0.00% NA
Indica III  913 43.30% 56.70% 0.00% 0.00% NA
Indica Intermediate  786 38.00% 61.80% 0.13% 0.00% NA
Temperate Japonica  767 65.10% 34.90% 0.00% 0.00% NA
Tropical Japonica  504 96.40% 3.60% 0.00% 0.00% NA
Japonica Intermediate  241 88.80% 10.80% 0.41% 0.00% NA
VI/Aromatic  96 71.90% 27.10% 1.04% 0.00% NA
Intermediate  90 45.60% 54.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607995576 C -> T LOC_Os06g14324.1 upstream_gene_variant ; 4618.0bp to feature; MODIFIER silent_mutation Average:99.088; most accessible tissue: Zhenshan97 flower, score: 99.404 N N N N
vg0607995576 C -> T LOC_Os06g14340.1 upstream_gene_variant ; 2832.0bp to feature; MODIFIER silent_mutation Average:99.088; most accessible tissue: Zhenshan97 flower, score: 99.404 N N N N
vg0607995576 C -> T LOC_Os06g14350.1 downstream_gene_variant ; 1315.0bp to feature; MODIFIER silent_mutation Average:99.088; most accessible tissue: Zhenshan97 flower, score: 99.404 N N N N
vg0607995576 C -> T LOC_Os06g14350.2 downstream_gene_variant ; 1315.0bp to feature; MODIFIER silent_mutation Average:99.088; most accessible tissue: Zhenshan97 flower, score: 99.404 N N N N
vg0607995576 C -> T LOC_Os06g14340-LOC_Os06g14350 intergenic_region ; MODIFIER silent_mutation Average:99.088; most accessible tissue: Zhenshan97 flower, score: 99.404 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0607995576 C T -0.03 -0.07 -0.06 -0.04 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607995576 NA 1.17E-07 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607995576 NA 6.30E-06 mr1268 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607995576 NA 9.82E-06 mr1279 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607995576 NA 6.10E-08 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607995576 NA 1.48E-06 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607995576 9.68E-06 1.41E-08 mr1170_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607995576 NA 8.33E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607995576 NA 5.15E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607995576 NA 2.49E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607995576 NA 5.37E-06 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607995576 NA 1.25E-06 mr1341_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607995576 NA 9.25E-07 mr1492_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607995576 NA 9.47E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607995576 3.60E-06 1.12E-09 mr1668_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607995576 NA 3.32E-08 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607995576 NA 3.27E-07 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607995576 NA 1.63E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251