Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0607988536:

Variant ID: vg0607988536 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 7988536
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.63, A: 0.37, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

AAAATGAAGGGGGGTTCCACTCGCTTACTTTACTCTGGTTTGAATCAAATTTAGCTTGATACGGGTGCCTAAGTTTATACTGACGGGGTATATATATGGC[G/A]
AAAATAGATAAACTATAGGTAATTTTTTTTGAATCGGGTTCCTGGGCACCCCCTAGCTATATTAGCTCCACCCCTGCCAGTGAGTAGGGAAGAAAATAGT

Reverse complement sequence

ACTATTTTCTTCCCTACTCACTGGCAGGGGTGGAGCTAATATAGCTAGGGGGTGCCCAGGAACCCGATTCAAAAAAAATTACCTATAGTTTATCTATTTT[C/T]
GCCATATATATACCCCGTCAGTATAAACTTAGGCACCCGTATCAAGCTAAATTTGATTCAAACCAGAGTAAAGTAAGCGAGTGGAACCCCCCTTCATTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.90%	33.00%	0.04%	0.00%	NA
All Indica	2759	61.40%	38.50%	0.04%	0.00%	NA
All Japonica	1512	84.40%	15.60%	0.00%	0.00%	NA
Aus	269	9.30%	90.70%	0.00%	0.00%	NA
Indica I	595	38.70%	61.30%	0.00%	0.00%	NA
Indica II	465	92.90%	7.10%	0.00%	0.00%	NA
Indica III	913	58.30%	41.70%	0.00%	0.00%	NA
Indica Intermediate	786	63.70%	36.10%	0.13%	0.00%	NA
Temperate Japonica	767	73.90%	26.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	85.90%	14.10%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	86.70%	12.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0607988536	G -> A	LOC_Os06g14324.2	upstream_gene_variant ; 587.0bp to feature; MODIFIER	silent_mutation	Average:92.444; most accessible tissue: Minghui63 flag leaf, score: 96.892	N	N	N	N
vg0607988536	G -> A	LOC_Os06g14310.1	downstream_gene_variant ; 4677.0bp to feature; MODIFIER	silent_mutation	Average:92.444; most accessible tissue: Minghui63 flag leaf, score: 96.892	N	N	N	N
vg0607988536	G -> A	LOC_Os06g14340.1	downstream_gene_variant ; 3486.0bp to feature; MODIFIER	silent_mutation	Average:92.444; most accessible tissue: Minghui63 flag leaf, score: 96.892	N	N	N	N
vg0607988536	G -> A	LOC_Os06g14324.1	intron_variant ; MODIFIER	silent_mutation	Average:92.444; most accessible tissue: Minghui63 flag leaf, score: 96.892	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0607988536	G	A	-0.03	-0.03	-0.02	-0.02	-0.02	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0607988536	NA	6.87E-07	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607988536	NA	3.30E-07	mr1328	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607988536	NA	7.91E-06	mr1328	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607988536	NA	1.29E-06	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607988536	NA	3.31E-06	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607988536	NA	4.72E-07	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607988536	NA	3.89E-06	mr1278_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607988536	4.63E-06	NA	mr1550_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607988536	4.16E-09	6.00E-12	mr1668_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607988536	NA	9.84E-06	mr1702_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607988536	9.93E-06	9.93E-06	mr1711_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607988536	6.79E-06	NA	mr1754_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607988536	NA	1.06E-08	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251