Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0607912744:

Variant ID: vg0607912744 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 7912744
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

ATATCGGATATACGGACACACATTTGAAGTATTAAACGCAGTCTAATAACAAAACAAATTATAGATTCAGCCATGAAACTGCGAGACAAATTTATTAAGC[C/T]
TAATGAATCAGTCATTAGCAAATGTTACTGTATCACCATATTATCAAATCGTGGCGCAATTAGATTTAAAAGATTTGTCTCACAATTTACACGCAATCTA

Reverse complement sequence

TAGATTGCGTGTAAATTGTGAGACAAATCTTTTAAATCTAATTGCGCCACGATTTGATAATATGGTGATACAGTAACATTTGCTAATGACTGATTCATTA[G/A]
GCTTAATAAATTTGTCTCGCAGTTTCATGGCTGAATCTATAATTTGTTTTGTTATTAGACTGCGTTTAATACTTCAAATGTGTGTCCGTATATCCGATAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.90%	47.10%	0.02%	0.00%	NA
All Indica	2759	22.00%	78.00%	0.04%	0.00%	NA
All Japonica	1512	99.30%	0.70%	0.00%	0.00%	NA
Aus	269	85.50%	14.50%	0.00%	0.00%	NA
Indica I	595	10.80%	89.10%	0.17%	0.00%	NA
Indica II	465	67.70%	32.30%	0.00%	0.00%	NA
Indica III	913	2.10%	97.90%	0.00%	0.00%	NA
Indica Intermediate	786	26.60%	73.40%	0.00%	0.00%	NA
Temperate Japonica	767	99.20%	0.80%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	75.60%	24.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0607912744	C -> T	LOC_Os06g14180.1	upstream_gene_variant ; 2847.0bp to feature; MODIFIER	silent_mutation	Average:42.818; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg0607912744	C -> T	LOC_Os06g14170-LOC_Os06g14180	intergenic_region ; MODIFIER	silent_mutation	Average:42.818; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0607912744	NA	1.08E-18	mr1133_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607912744	NA	1.00E-06	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607912744	NA	1.67E-06	mr1272_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607912744	NA	2.23E-11	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607912744	NA	4.10E-06	mr1677_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607912744	NA	2.67E-06	mr1931_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251