\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607674962:

Variant ID: vg0607674962 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7674962
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGTTGACAGAGAAGGGGGGTGTTAGGTGATCGACCGCCCCGGTGGCTGGCAGGGTGGGACCCGCACGTCGCACCTGTTTAGGTGAGCTTAAGATTCTGA[G/C]
AAACTGTTGGTTGATAGCCATCTTATGAGAATACTTCTTACTAATTTAGTGCGTTTTCTGGATTCTACAACTTTAGTTTTTGAGAATCTGAATGAAATAC

Reverse complement sequence

GTATTTCATTCAGATTCTCAAAAACTAAAGTTGTAGAATCCAGAAAACGCACTAAATTAGTAAGAAGTATTCTCATAAGATGGCTATCAACCAACAGTTT[C/G]
TCAGAATCTTAAGCTCACCTAAACAGGTGCGACGTGCGGGTCCCACCCTGCCAGCCACCGGGGCGGTCGATCACCTAACACCCCCCTTCTCTGTCAACAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.50% 20.50% 0.08% 0.00% NA
All Indica  2759 67.40% 32.50% 0.14% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 77.30% 22.70% 0.00% 0.00% NA
Indica I  595 67.90% 31.90% 0.17% 0.00% NA
Indica II  465 95.30% 4.70% 0.00% 0.00% NA
Indica III  913 50.60% 49.30% 0.11% 0.00% NA
Indica Intermediate  786 70.00% 29.80% 0.25% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607674962 G -> C LOC_Os06g13830.1 upstream_gene_variant ; 184.0bp to feature; MODIFIER silent_mutation Average:95.448; most accessible tissue: Zhenshan97 root, score: 99.769 N N N N
vg0607674962 G -> C LOC_Os06g13820.1 downstream_gene_variant ; 4927.0bp to feature; MODIFIER silent_mutation Average:95.448; most accessible tissue: Zhenshan97 root, score: 99.769 N N N N
vg0607674962 G -> C LOC_Os06g13820.2 downstream_gene_variant ; 4928.0bp to feature; MODIFIER silent_mutation Average:95.448; most accessible tissue: Zhenshan97 root, score: 99.769 N N N N
vg0607674962 G -> C LOC_Os06g13830-LOC_Os06g13839 intergenic_region ; MODIFIER silent_mutation Average:95.448; most accessible tissue: Zhenshan97 root, score: 99.769 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0607674962 G C 0.01 -0.01 -0.03 -0.01 0.01 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607674962 NA 3.27E-06 mr1184_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607674962 NA 1.68E-06 mr1278_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607674962 4.09E-06 4.09E-06 mr1284_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607674962 2.64E-06 2.64E-06 mr1286_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607674962 NA 4.78E-07 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607674962 7.93E-06 NA mr1374_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607674962 7.22E-07 7.22E-07 mr1374_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607674962 NA 5.55E-06 mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607674962 NA 2.98E-06 mr1683_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607674962 NA 3.02E-06 mr1816_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607674962 1.47E-06 1.47E-06 mr1816_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607674962 7.65E-06 7.64E-06 mr1822_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607674962 2.60E-06 2.60E-06 mr1822_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607674962 8.89E-06 8.89E-06 mr1847_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251