\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607629449:

Variant ID: vg0607629449 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7629449
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, A: 0.14, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


CTCTTATATCATAAAAACGGAAGAAGTAGTAATAAAAATATTATCATAAAAGTTTAAATAAGCCAAACGATTAAACACTAGACATATAAATCTACCGCTA[A/C]
CCTTAAAATGAGATGAGATAGAGGGACAGAGCGGCTAATTAACGCGTATCCCAATCACGCAAGGGATTAAAACCCCTCGTCCGAATTGCTAACACCACAC

Reverse complement sequence

GTGTGGTGTTAGCAATTCGGACGAGGGGTTTTAATCCCTTGCGTGATTGGGATACGCGTTAATTAGCCGCTCTGTCCCTCTATCTCATCTCATTTTAAGG[T/G]
TAGCGGTAGATTTATATGTCTAGTGTTTAATCGTTTGGCTTATTTAAACTTTTATGATAATATTTTTATTACTACTTCTTCCGTTTTTATGATATAAGAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.10% 48.10% 0.36% 0.38% NA
All Indica  2759 30.20% 69.40% 0.14% 0.22% NA
All Japonica  1512 86.40% 12.20% 0.66% 0.79% NA
Aus  269 71.70% 27.90% 0.37% 0.00% NA
Indica I  595 14.80% 84.90% 0.17% 0.17% NA
Indica II  465 67.10% 31.80% 0.43% 0.65% NA
Indica III  913 18.90% 81.10% 0.00% 0.00% NA
Indica Intermediate  786 33.10% 66.50% 0.13% 0.25% NA
Temperate Japonica  767 95.30% 1.80% 1.30% 1.56% NA
Tropical Japonica  504 68.50% 31.50% 0.00% 0.00% NA
Japonica Intermediate  241 95.40% 4.60% 0.00% 0.00% NA
VI/Aromatic  96 25.00% 74.00% 1.04% 0.00% NA
Intermediate  90 67.80% 31.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607629449 A -> C LOC_Os06g13760.1 upstream_gene_variant ; 98.0bp to feature; MODIFIER silent_mutation Average:98.116; most accessible tissue: Zhenshan97 flower, score: 99.404 N N N N
vg0607629449 A -> C LOC_Os06g13750-LOC_Os06g13760 intergenic_region ; MODIFIER silent_mutation Average:98.116; most accessible tissue: Zhenshan97 flower, score: 99.404 N N N N
vg0607629449 A -> DEL N N silent_mutation Average:98.116; most accessible tissue: Zhenshan97 flower, score: 99.404 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0607629449 A C 0.0 0.02 0.01 0.04 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607629449 NA 4.83E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607629449 NA 9.55E-08 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607629449 NA 7.86E-07 mr1185_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607629449 NA 4.42E-07 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607629449 NA 2.29E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607629449 NA 2.18E-12 mr1399_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607629449 NA 1.56E-07 mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607629449 NA 9.51E-10 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607629449 NA 5.16E-06 mr1662_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607629449 NA 7.40E-08 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251