\
| Variant ID: vg0607377849 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 7377849 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CAGCGCAATACTACTTGGTGCTGAGAGCTTCATAGGATAAAACCATAAATATGCACTTTGATTTACAAAAGGTTTGCTTGGCTTAGGTCTTGTCTAGTTC[T/C]
TAAAATAAAAACTTTTCACCTATCACATCGAATGTTTGGAAACATGTATGGAGTATTAAATGTGTACAAAATAAAAAAACTAATTATACAGTTTACGTGT
ACACGTAAACTGTATAATTAGTTTTTTTATTTTGTACACATTTAATACTCCATACATGTTTCCAAACATTCGATGTGATAGGTGAAAAGTTTTTATTTTA[A/G]
GAACTAGACAAGACCTAAGCCAAGCAAACCTTTTGTAAATCAAAGTGCATATTTATGGTTTTATCCTATGAAGCTCTCAGCACCAAGTAGTATTGCGCTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.60% | 5.00% | 4.87% | 50.59% | NA |
| All Indica | 2759 | 4.30% | 7.80% | 5.73% | 82.13% | NA |
| All Japonica | 1512 | 98.40% | 0.20% | 0.26% | 1.12% | NA |
| Aus | 269 | 68.40% | 1.10% | 4.09% | 26.39% | NA |
| Indica I | 595 | 3.20% | 3.90% | 4.87% | 88.07% | NA |
| Indica II | 465 | 4.90% | 9.90% | 6.02% | 79.14% | NA |
| Indica III | 913 | 2.50% | 11.00% | 6.24% | 80.28% | NA |
| Indica Intermediate | 786 | 6.90% | 6.00% | 5.60% | 81.55% | NA |
| Temperate Japonica | 767 | 98.80% | 0.00% | 0.13% | 1.04% | NA |
| Tropical Japonica | 504 | 99.00% | 0.00% | 0.00% | 0.99% | NA |
| Japonica Intermediate | 241 | 95.90% | 1.20% | 1.24% | 1.66% | NA |
| VI/Aromatic | 96 | 29.20% | 11.50% | 53.12% | 6.25% | NA |
| Intermediate | 90 | 57.80% | 1.10% | 6.67% | 34.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0607377849 | T -> C | LOC_Os06g13410.1 | upstream_gene_variant ; 917.0bp to feature; MODIFIER | silent_mutation | Average:31.161; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0607377849 | T -> C | LOC_Os06g13420.1 | downstream_gene_variant ; 849.0bp to feature; MODIFIER | silent_mutation | Average:31.161; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0607377849 | T -> C | LOC_Os06g13410-LOC_Os06g13420 | intergenic_region ; MODIFIER | silent_mutation | Average:31.161; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0607377849 | T -> DEL | N | N | silent_mutation | Average:31.161; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0607377849 | NA | 5.89E-11 | mr1138 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607377849 | NA | 3.02E-14 | mr1138_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607377849 | 1.68E-06 | NA | mr1707_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607377849 | 3.12E-06 | NA | mr1707_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607377849 | 2.05E-06 | NA | mr1728_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607377849 | 4.13E-06 | 1.52E-06 | mr1728_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607377849 | 6.49E-06 | 8.21E-08 | mr1860_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607377849 | 3.63E-07 | NA | mr1973_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0607377849 | NA | 2.09E-08 | mr1973_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |