\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0607377849:

Variant ID: vg0607377849 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 7377849
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGCGCAATACTACTTGGTGCTGAGAGCTTCATAGGATAAAACCATAAATATGCACTTTGATTTACAAAAGGTTTGCTTGGCTTAGGTCTTGTCTAGTTC[T/C]
TAAAATAAAAACTTTTCACCTATCACATCGAATGTTTGGAAACATGTATGGAGTATTAAATGTGTACAAAATAAAAAAACTAATTATACAGTTTACGTGT

Reverse complement sequence

ACACGTAAACTGTATAATTAGTTTTTTTATTTTGTACACATTTAATACTCCATACATGTTTCCAAACATTCGATGTGATAGGTGAAAAGTTTTTATTTTA[A/G]
GAACTAGACAAGACCTAAGCCAAGCAAACCTTTTGTAAATCAAAGTGCATATTTATGGTTTTATCCTATGAAGCTCTCAGCACCAAGTAGTATTGCGCTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.60% 5.00% 4.87% 50.59% NA
All Indica  2759 4.30% 7.80% 5.73% 82.13% NA
All Japonica  1512 98.40% 0.20% 0.26% 1.12% NA
Aus  269 68.40% 1.10% 4.09% 26.39% NA
Indica I  595 3.20% 3.90% 4.87% 88.07% NA
Indica II  465 4.90% 9.90% 6.02% 79.14% NA
Indica III  913 2.50% 11.00% 6.24% 80.28% NA
Indica Intermediate  786 6.90% 6.00% 5.60% 81.55% NA
Temperate Japonica  767 98.80% 0.00% 0.13% 1.04% NA
Tropical Japonica  504 99.00% 0.00% 0.00% 0.99% NA
Japonica Intermediate  241 95.90% 1.20% 1.24% 1.66% NA
VI/Aromatic  96 29.20% 11.50% 53.12% 6.25% NA
Intermediate  90 57.80% 1.10% 6.67% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0607377849 T -> C LOC_Os06g13410.1 upstream_gene_variant ; 917.0bp to feature; MODIFIER silent_mutation Average:31.161; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0607377849 T -> C LOC_Os06g13420.1 downstream_gene_variant ; 849.0bp to feature; MODIFIER silent_mutation Average:31.161; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0607377849 T -> C LOC_Os06g13410-LOC_Os06g13420 intergenic_region ; MODIFIER silent_mutation Average:31.161; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0607377849 T -> DEL N N silent_mutation Average:31.161; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0607377849 NA 5.89E-11 mr1138 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607377849 NA 3.02E-14 mr1138_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607377849 1.68E-06 NA mr1707_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607377849 3.12E-06 NA mr1707_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607377849 2.05E-06 NA mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607377849 4.13E-06 1.52E-06 mr1728_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607377849 6.49E-06 8.21E-08 mr1860_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607377849 3.63E-07 NA mr1973_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0607377849 NA 2.09E-08 mr1973_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251