\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0606864427:

Variant ID: vg0606864427 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 6864427
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCGTGCGTGGAGCTTAGTTGTCTACCGTATTAGAGCAGGTACAATAGCCGGCTATAACCATATATCGAGAAGAAAAAAGAAGAGAGAGAAGAAAGCGGG[C/T]
TACAGATTTGTAGCCGGCTGCAACACAGACTTCAAGATATTTTGTGTGTATGAGAGGTGGGATCGGATATTAAGAGCAAGTTTAATAGTATAGCCAACTA

Reverse complement sequence

TAGTTGGCTATACTATTAAACTTGCTCTTAATATCCGATCCCACCTCTCATACACACAAAATATCTTGAAGTCTGTGTTGCAGCCGGCTACAAATCTGTA[G/A]
CCCGCTTTCTTCTCTCTCTTCTTTTTTCTTCTCGATATATGGTTATAGCCGGCTATTGTACCTGCTCTAATACGGTAGACAACTAAGCTCCACGCACGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.10% 14.70% 0.21% 0.00% NA
All Indica  2759 75.00% 24.60% 0.36% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 96.30% 2.40% 1.34% 0.00% NA
Indica II  465 72.70% 27.30% 0.00% 0.00% NA
Indica III  913 56.30% 43.60% 0.11% 0.00% NA
Indica Intermediate  786 82.10% 17.80% 0.13% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0606864427 C -> T LOC_Os06g12610.1 upstream_gene_variant ; 1966.0bp to feature; MODIFIER silent_mutation Average:74.207; most accessible tissue: Zhenshan97 panicle, score: 93.02 N N N N
vg0606864427 C -> T LOC_Os06g12600-LOC_Os06g12610 intergenic_region ; MODIFIER silent_mutation Average:74.207; most accessible tissue: Zhenshan97 panicle, score: 93.02 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0606864427 C T 0.02 -0.01 0.01 0.02 0.02 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0606864427 NA 3.10E-06 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606864427 NA 3.22E-06 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606864427 NA 3.09E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606864427 2.18E-06 6.44E-09 mr1377 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606864427 3.83E-07 3.83E-07 mr1377 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606864427 NA 6.73E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606864427 NA 7.57E-08 mr1534 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606864427 NA 2.26E-06 mr1691 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606864427 NA 2.90E-06 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606864427 NA 5.34E-06 mr1881 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606864427 NA 3.41E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251