\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0606713553:

Variant ID: vg0606713553 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 6713553
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.05, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


GCCTCCGCGTAACCCTCGCCGCCGCCGCTCCGTGTTCCCCGCCTGTAGCCGCAGAGAGGAAGAGTGAGAGAGAGAGGAAGAATGGAAGAGGAGTATGACA[G/A]
GTGGGTCCTATATTTTTTAACAAATAGAATACTGACTGTACTGCCACGTGTACGCTACGTAGATCAAAACCACCGTGAATTTAGTCAAGGGGGGTAATTC

Reverse complement sequence

GAATTACCCCCCTTGACTAAATTCACGGTGGTTTTGATCTACGTAGCGTACACGTGGCAGTACAGTCAGTATTCTATTTGTTAAAAAATATAGGACCCAC[C/T]
TGTCATACTCCTCTTCCATTCTTCCTCTCTCTCTCACTCTTCCTCTCTGCGGCTACAGGCGGGGAACACGGAGCGGCGGCGGCGAGGGTTACGCGGAGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.30% 15.50% 0.80% 6.39% NA
All Indica  2759 73.60% 18.80% 0.83% 6.74% NA
All Japonica  1512 99.20% 0.30% 0.00% 0.46% NA
Aus  269 7.10% 75.50% 4.09% 13.38% NA
Indica I  595 68.40% 30.10% 0.17% 1.34% NA
Indica II  465 92.90% 6.00% 0.22% 0.86% NA
Indica III  913 72.80% 11.20% 1.20% 14.79% NA
Indica Intermediate  786 67.20% 26.60% 1.27% 4.96% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.60% 0.00% 0.20% NA
Japonica Intermediate  241 96.70% 0.80% 0.00% 2.49% NA
VI/Aromatic  96 29.20% 1.00% 2.08% 67.71% NA
Intermediate  90 84.40% 4.40% 2.22% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0606713553 G -> A LOC_Os06g12390.1 upstream_gene_variant ; 2333.0bp to feature; MODIFIER silent_mutation Average:89.811; most accessible tissue: Minghui63 root, score: 97.778 N N N N
vg0606713553 G -> A LOC_Os06g12390.2 upstream_gene_variant ; 2333.0bp to feature; MODIFIER silent_mutation Average:89.811; most accessible tissue: Minghui63 root, score: 97.778 N N N N
vg0606713553 G -> A LOC_Os06g12380.1 downstream_gene_variant ; 332.0bp to feature; MODIFIER silent_mutation Average:89.811; most accessible tissue: Minghui63 root, score: 97.778 N N N N
vg0606713553 G -> A LOC_Os06g12380-LOC_Os06g12390 intergenic_region ; MODIFIER silent_mutation Average:89.811; most accessible tissue: Minghui63 root, score: 97.778 N N N N
vg0606713553 G -> DEL N N silent_mutation Average:89.811; most accessible tissue: Minghui63 root, score: 97.778 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0606713553 G A -0.07 -0.03 -0.02 -0.06 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0606713553 NA 2.34E-15 mr1158 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606713553 NA 3.30E-14 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606713553 NA 2.06E-10 mr1207 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606713553 NA 3.81E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606713553 NA 8.21E-06 mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606713553 NA 8.14E-06 mr1283 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606713553 NA 3.56E-06 mr1284 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606713553 NA 3.47E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606713553 NA 5.20E-07 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606713553 NA 1.24E-06 mr1569 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606713553 NA 2.02E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606713553 NA 5.50E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606713553 NA 3.99E-07 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606713553 NA 1.47E-09 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606713553 NA 2.75E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606713553 NA 2.79E-07 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606713553 NA 3.34E-06 mr1201_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606713553 NA 4.55E-07 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251