Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0606682474:

Variant ID: vg0606682474 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 6682474
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

CTCGGTACCTGTGATACCTAGCACCTGATACCTGTAATACTCGTGTAAGAGAATAGTTAATATGTCTATCCCGTTGCAACGGGATCCTGTTTTGTAGCAA[C/T]
TCTCTTTGGGTTTTGTTGTCCAGCATGAATCTCAAAGTACTCGTACGGTCACATTCCTATCAGGTTAACAGCAAATGGTGCATAGACCGTTCTTTTTTTT

Reverse complement sequence

AAAAAAAAGAACGGTCTATGCACCATTTGCTGTTAACCTGATAGGAATGTGACCGTACGAGTACTTTGAGATTCATGCTGGACAACAAAACCCAAAGAGA[G/A]
TTGCTACAAAACAGGATCCCGTTGCAACGGGATAGACATATTAACTATTCTCTTACACGAGTATTACAGGTATCAGGTGCTAGGTATCACAGGTACCGAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.20%	4.80%	0.00%	0.00%	NA
All Indica	2759	92.00%	8.00%	0.00%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	98.50%	1.50%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	82.90%	17.10%	0.00%	0.00%	NA
Indica Intermediate	786	93.40%	6.60%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0606682474	C -> T	LOC_Os06g12330.1	3_prime_UTR_variant ; 106.0bp to feature; MODIFIER	silent_mutation	Average:73.726; most accessible tissue: Minghui63 flag leaf, score: 80.786	N	N	N	N
vg0606682474	C -> T	LOC_Os06g12320.1	downstream_gene_variant ; 1610.0bp to feature; MODIFIER	silent_mutation	Average:73.726; most accessible tissue: Minghui63 flag leaf, score: 80.786	N	N	N	N
vg0606682474	C -> T	LOC_Os06g12340.1	downstream_gene_variant ; 4095.0bp to feature; MODIFIER	silent_mutation	Average:73.726; most accessible tissue: Minghui63 flag leaf, score: 80.786	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0606682474	3.25E-06	3.25E-06	mr1260	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606682474	NA	4.85E-06	mr1561	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606682474	NA	1.43E-06	mr1807	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606682474	NA	4.57E-08	mr1970	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606682474	NA	7.30E-12	mr1973	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606682474	NA	5.04E-07	mr1244_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606682474	NA	2.60E-06	mr1676_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606682474	NA	8.37E-11	mr1798_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606682474	4.29E-08	2.44E-12	mr1970_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606682474	5.13E-07	2.69E-14	mr1973_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251