Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0606311325:

Variant ID: vg0606311325 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 6311325
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


CATGGCTATCCGTGCGCCATACCTGATCAACGTACGTGTGGGGCTCTTGGTACGTTCTTGGGGGAGCTAGCGCGACCTATAGCCACACCTCCCATGCTCA[A/C]
AGTGGCGTATAAATTAAAGAAAATATCTAAGTTCCTATACATACTTAATTTTCTAATTATTGACTAATATAATAACTATAATAACATAACTCAGTTATAA

Reverse complement sequence

TTATAACTGAGTTATGTTATTATAGTTATTATATTAGTCAATAATTAGAAAATTAAGTATGTATAGGAACTTAGATATTTTCTTTAATTTATACGCCACT[T/G]
TGAGCATGGGAGGTGTGGCTATAGGTCGCGCTAGCTCCCCCAAGAACGTACCAAGAGCCCCACACGTACGTTGATCAGGTATGGCGCACGGATAGCCATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.40% 36.60% 0.02% 0.00% NA
All Indica  2759 81.70% 18.30% 0.00% 0.00% NA
All Japonica  1512 22.60% 77.40% 0.00% 0.00% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 68.20% 31.80% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 81.60% 18.40% 0.00% 0.00% NA
Indica Intermediate  786 81.80% 18.20% 0.00% 0.00% NA
Temperate Japonica  767 1.60% 98.40% 0.00% 0.00% NA
Tropical Japonica  504 56.90% 43.10% 0.00% 0.00% NA
Japonica Intermediate  241 17.40% 82.60% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 61.10% 37.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0606311325 A -> C LOC_Os06g11860.1 upstream_gene_variant ; 4664.0bp to feature; MODIFIER silent_mutation Average:80.404; most accessible tissue: Zhenshan97 panicle, score: 96.214 N N N N
vg0606311325 A -> C LOC_Os06g11870.1 upstream_gene_variant ; 1044.0bp to feature; MODIFIER silent_mutation Average:80.404; most accessible tissue: Zhenshan97 panicle, score: 96.214 N N N N
vg0606311325 A -> C LOC_Os06g11880.1 upstream_gene_variant ; 4969.0bp to feature; MODIFIER silent_mutation Average:80.404; most accessible tissue: Zhenshan97 panicle, score: 96.214 N N N N
vg0606311325 A -> C LOC_Os06g11870-LOC_Os06g11880 intergenic_region ; MODIFIER silent_mutation Average:80.404; most accessible tissue: Zhenshan97 panicle, score: 96.214 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0606311325 A C 0.0 -0.06 -0.05 0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0606311325 NA 1.29E-06 mr1091 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606311325 2.94E-06 6.42E-08 mr1798 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606311325 NA 2.01E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606311325 5.15E-06 5.15E-06 mr1159_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606311325 4.84E-06 4.84E-06 mr1312_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606311325 NA 1.25E-07 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606311325 NA 4.39E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606311325 NA 3.73E-08 mr1579_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606311325 4.71E-06 4.71E-06 mr1674_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606311325 NA 1.32E-06 mr1738_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606311325 4.86E-06 4.86E-06 mr1760_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606311325 NA 1.64E-07 mr1798_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606311325 NA 7.84E-06 mr1812_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606311325 7.69E-06 7.69E-06 mr1832_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606311325 4.64E-06 4.64E-06 mr1843_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0606311325 NA 2.18E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251