\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605857548:

Variant ID: vg0605857548 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 5857548
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.75, A: 0.25, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


GTAAAGTTGATCGCAAAGGTCGTCATTTCTACAGTGTATCCAGTGTGAAAGAGCAAAAGAAATGCTGACGAATGTATAGTACTTTACATGTTTCACAGAT[A/C]
ACAGTTTCAGGAAAGGGAATTTATCCAATTCAGGATATTGTTGGTACCAGAGATATTGTACACTACAGACATGCTTCCCTGATGCAGAAGACGCTCTTGA

Reverse complement sequence

TCAAGAGCGTCTTCTGCATCAGGGAAGCATGTCTGTAGTGTACAATATCTCTGGTACCAACAATATCCTGAATTGGATAAATTCCCTTTCCTGAAACTGT[T/G]
ATCTGTGAAACATGTAAAGTACTATACATTCGTCAGCATTTCTTTTGCTCTTTCACACTGGATACACTGTAGAAATGACGACCTTTGCGATCAACTTTAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.30% 36.30% 0.11% 0.28% NA
All Indica  2759 65.30% 34.20% 0.11% 0.36% NA
All Japonica  1512 75.30% 24.50% 0.07% 0.13% NA
Aus  269 1.50% 98.50% 0.00% 0.00% NA
Indica I  595 91.10% 8.90% 0.00% 0.00% NA
Indica II  465 41.10% 57.60% 0.43% 0.86% NA
Indica III  913 60.10% 39.40% 0.11% 0.33% NA
Indica Intermediate  786 66.20% 33.50% 0.00% 0.38% NA
Temperate Japonica  767 99.10% 0.80% 0.00% 0.13% NA
Tropical Japonica  504 41.90% 57.70% 0.20% 0.20% NA
Japonica Intermediate  241 69.70% 30.30% 0.00% 0.00% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 52.20% 45.60% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0605857548 A -> C LOC_Os06g11170.1 3_prime_UTR_variant ; 180.0bp to feature; MODIFIER silent_mutation Average:92.017; most accessible tissue: Callus, score: 97.774 N N N N
vg0605857548 A -> C LOC_Os06g11170.2 3_prime_UTR_variant ; 180.0bp to feature; MODIFIER silent_mutation Average:92.017; most accessible tissue: Callus, score: 97.774 N N N N
vg0605857548 A -> C LOC_Os06g11160.1 downstream_gene_variant ; 2879.0bp to feature; MODIFIER silent_mutation Average:92.017; most accessible tissue: Callus, score: 97.774 N N N N
vg0605857548 A -> C LOC_Os06g11180.1 downstream_gene_variant ; 4615.0bp to feature; MODIFIER silent_mutation Average:92.017; most accessible tissue: Callus, score: 97.774 N N N N
vg0605857548 A -> DEL N N silent_mutation Average:92.017; most accessible tissue: Callus, score: 97.774 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0605857548 A C 0.0 0.01 0.0 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0605857548 NA 4.19E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857548 NA 3.52E-06 mr1308 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857548 NA 8.71E-06 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857548 NA 5.45E-08 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857548 NA 4.14E-09 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857548 1.19E-06 NA mr1608 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857548 NA 3.32E-06 mr1608 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857548 NA 9.65E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857548 NA 4.03E-06 mr1725 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857548 NA 1.12E-06 mr1734 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857548 NA 1.19E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857548 5.33E-06 5.33E-06 mr1581_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857548 NA 4.33E-06 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857548 NA 1.50E-06 mr1819_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857548 NA 6.31E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251