\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0605857206:

Variant ID: vg0605857206 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 5857206
Reference Allele: TAlternative Allele: C,TC
Primary Allele: CSecondary Allele: TC

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


CCGCTGAAACAGGTTGGCAGTTGGTGGCAACTCTGCTGCAGAATTATTTGCAGCATGACAGGTGAAGTTCTAGGCATCTAGCTGCAAGTCGTATTCCCTT[T/C,TC]
GTCTAAAAAAAAAAATCTAGAACTTAATATGACAACGAATCTGAATAGAATTATATCCAGATTCATAATATTACGATGTGATTTTTCATGGAACAGAGGG

Reverse complement sequence

CCCTCTGTTCCATGAAAAATCACATCGTAATATTATGAATCTGGATATAATTCTATTCAGATTCGTTGTCATATTAAGTTCTAGATTTTTTTTTTTAGAC[A/G,GA]
AAGGGAATACGACTTGCAGCTAGATGCCTAGAACTTCACCTGTCATGCTGCAAATAATTCTGCAGCAGAGTTGCCACCAACTGCCAACCTGTTTCAGCGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of TC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.00% 13.80% 5.63% 0.00% T: 9.56%
All Indica  2759 72.10% 22.30% 4.24% 0.00% T: 1.30%
All Japonica  1512 61.90% 1.30% 9.59% 0.00% T: 27.18%
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 78.00% 5.40% 13.28% 0.00% T: 3.36%
Indica II  465 40.90% 55.70% 2.58% 0.00% T: 0.86%
Indica III  913 81.40% 18.40% 0.22% 0.00% NA
Indica Intermediate  786 75.40% 20.00% 3.05% 0.00% T: 1.53%
Temperate Japonica  767 38.20% 0.10% 16.17% 0.00% T: 45.50%
Tropical Japonica  504 92.70% 3.60% 0.60% 0.00% T: 3.17%
Japonica Intermediate  241 73.00% 0.40% 7.47% 0.00% T: 19.09%
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 75.60% 14.40% 4.44% 0.00% T: 5.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0605857206 T -> C LOC_Os06g11160.1 downstream_gene_variant ; 2537.0bp to feature; MODIFIER silent_mutation Average:95.583; most accessible tissue: Minghui63 young leaf, score: 98.868 N N N N
vg0605857206 T -> C LOC_Os06g11170.1 downstream_gene_variant ; 29.0bp to feature; MODIFIER silent_mutation Average:95.583; most accessible tissue: Minghui63 young leaf, score: 98.868 N N N N
vg0605857206 T -> C LOC_Os06g11180.1 downstream_gene_variant ; 4957.0bp to feature; MODIFIER silent_mutation Average:95.583; most accessible tissue: Minghui63 young leaf, score: 98.868 N N N N
vg0605857206 T -> C LOC_Os06g11170.2 downstream_gene_variant ; 29.0bp to feature; MODIFIER silent_mutation Average:95.583; most accessible tissue: Minghui63 young leaf, score: 98.868 N N N N
vg0605857206 T -> C LOC_Os06g11160-LOC_Os06g11170 intergenic_region ; MODIFIER silent_mutation Average:95.583; most accessible tissue: Minghui63 young leaf, score: 98.868 N N N N
vg0605857206 T -> TC LOC_Os06g11160.1 downstream_gene_variant ; 2538.0bp to feature; MODIFIER silent_mutation Average:95.583; most accessible tissue: Minghui63 young leaf, score: 98.868 N N N N
vg0605857206 T -> TC LOC_Os06g11170.1 downstream_gene_variant ; 28.0bp to feature; MODIFIER silent_mutation Average:95.583; most accessible tissue: Minghui63 young leaf, score: 98.868 N N N N
vg0605857206 T -> TC LOC_Os06g11180.1 downstream_gene_variant ; 4956.0bp to feature; MODIFIER silent_mutation Average:95.583; most accessible tissue: Minghui63 young leaf, score: 98.868 N N N N
vg0605857206 T -> TC LOC_Os06g11170.2 downstream_gene_variant ; 28.0bp to feature; MODIFIER silent_mutation Average:95.583; most accessible tissue: Minghui63 young leaf, score: 98.868 N N N N
vg0605857206 T -> TC LOC_Os06g11160-LOC_Os06g11170 intergenic_region ; MODIFIER silent_mutation Average:95.583; most accessible tissue: Minghui63 young leaf, score: 98.868 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0605857206 T C 0.0 -0.01 0.01 0.0 0.0 0.02
vg0605857206 T TC 0.0 0.0 0.04 0.02 0.03 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0605857206 NA 2.47E-07 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857206 1.63E-06 NA mr1552 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857206 NA 2.37E-07 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0605857206 NA 1.35E-09 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251