\
| Variant ID: vg0605572207 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 5572207 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GCCGCCGCAACAGCCTATCTTACCCCCACGTTCGACACCATCCCCCTTAATGTGCCCAACTCTGTCGCCACTGCTACAAGCAACTCCTAGCGCACCACCA[T/C]
TGTCGTCTCCAACAATAGAATTTCCCTACATCGCTGGCCTCGGGGATTCAAGATTAGAAAACTAGGCTTTTTCCTTTACAAGCCTCATCCCAACATATAA
TTATATGTTGGGATGAGGCTTGTAAAGGAAAAAGCCTAGTTTTCTAATCTTGAATCCCCGAGGCCAGCGATGTAGGGAAATTCTATTGTTGGAGACGACA[A/G]
TGGTGGTGCGCTAGGAGTTGCTTGTAGCAGTGGCGACAGAGTTGGGCACATTAAGGGGGATGGTGTCGAACGTGGGGGTAAGATAGGCTGTTGCGGCGGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.70% | 1.50% | 1.82% | 0.00% | NA |
| All Indica | 2759 | 99.50% | 0.00% | 0.54% | 0.00% | NA |
| All Japonica | 1512 | 90.70% | 4.60% | 4.63% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 0.00% | 1.18% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.00% | 0.65% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.00% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 83.60% | 7.30% | 9.13% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0605572207 | T -> C | LOC_Os06g10680.1 | upstream_gene_variant ; 392.0bp to feature; MODIFIER | silent_mutation | Average:60.836; most accessible tissue: Zhenshan97 young leaf, score: 80.589 | N | N | N | N |
| vg0605572207 | T -> C | LOC_Os06g10670.1 | downstream_gene_variant ; 736.0bp to feature; MODIFIER | silent_mutation | Average:60.836; most accessible tissue: Zhenshan97 young leaf, score: 80.589 | N | N | N | N |
| vg0605572207 | T -> C | LOC_Os06g10690.1 | downstream_gene_variant ; 3660.0bp to feature; MODIFIER | silent_mutation | Average:60.836; most accessible tissue: Zhenshan97 young leaf, score: 80.589 | N | N | N | N |
| vg0605572207 | T -> C | LOC_Os06g10690.2 | downstream_gene_variant ; 3660.0bp to feature; MODIFIER | silent_mutation | Average:60.836; most accessible tissue: Zhenshan97 young leaf, score: 80.589 | N | N | N | N |
| vg0605572207 | T -> C | LOC_Os06g10670-LOC_Os06g10680 | intergenic_region ; MODIFIER | silent_mutation | Average:60.836; most accessible tissue: Zhenshan97 young leaf, score: 80.589 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0605572207 | 5.47E-06 | 4.54E-07 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605572207 | NA | 2.25E-06 | mr1409_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605572207 | 6.57E-06 | 2.90E-07 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605572207 | 4.33E-06 | 4.33E-06 | mr1645_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605572207 | 2.26E-06 | 2.26E-06 | mr1647_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0605572207 | NA | 8.79E-06 | mr1703_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |