\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604742724:

Variant ID: vg0604742724 (JBrowse)Variation Type: INDEL
Chromosome: chr06Position: 4742724
Reference Allele: TAlternative Allele: C,TACCTTAGTCTCAGGA
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 304. )

Flanking Sequence (100 bp) in Reference Genome:


AACTCCAACTCTCCGAGAAATCAGCCACACTACGACGCTGTTGTAGTACCCTGCTCTCAACTCTAGCTTGATCATGGACATCAGCTCTTCTCCTCCCACA[T/C,TACCTTAGTCTCAGGA]
TACCTTAGTCTCAGGATAGCGCAACGTTCTAATTAGCTTCTCATGTGAGCCATCTCATCTGGTAGGTCCCGGACGAAATAGATTGCCTGTTGAAGGTGTG

Reverse complement sequence

CACACCTTCAACAGGCAATCTATTTCGTCCGGGACCTACCAGATGAGATGGCTCACATGAGAAGCTAATTAGAACGTTGCGCTATCCTGAGACTAAGGTA[A/G,TCCTGAGACTAAGGTA]
TGTGGGAGGAGAAGAGCTGATGTCCATGATCAAGCTAGAGTTGAGAGCAGGGTACTACAACAGCGTCGTAGTGTGGCTGATTTCTCGGAGAGTTGGAGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.20% 16.80% 0.13% 0.00% TACCTTAGTCTCAGGA: 5.90%
All Indica  2759 99.30% 0.10% 0.07% 0.00% TACCTTAGTCTCAGGA: 0.47%
All Japonica  1512 36.00% 52.00% 0.20% 0.00% TACCTTAGTCTCAGGA: 11.84%
Aus  269 99.30% 0.00% 0.00% 0.00% TACCTTAGTCTCAGGA: 0.74%
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.20% 0.00% 0.00% TACCTTAGTCTCAGGA: 0.43%
Indica III  913 99.20% 0.10% 0.11% 0.00% TACCTTAGTCTCAGGA: 0.55%
Indica Intermediate  786 98.90% 0.30% 0.13% 0.00% TACCTTAGTCTCAGGA: 0.76%
Temperate Japonica  767 11.90% 85.00% 0.26% 0.00% TACCTTAGTCTCAGGA: 2.87%
Tropical Japonica  504 74.00% 7.30% 0.20% 0.00% TACCTTAGTCTCAGGA: 18.45%
Japonica Intermediate  241 33.20% 40.20% 0.00% 0.00% TACCTTAGTCTCAGGA: 26.56%
VI/Aromatic  96 22.90% 0.00% 0.00% 0.00% TACCTTAGTCTCAGGA: 77.08%
Intermediate  90 82.20% 4.40% 1.11% 0.00% TACCTTAGTCTCAGGA: 12.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0604742724 T -> C LOC_Os06g09390-LOC_Os06g09400 intergenic_region ; MODIFIER silent_mutation Average:55.336; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N
vg0604742724 T -> TACCTTAGTCTCAGGA LOC_Os06g09390-LOC_Os06g09400 intergenic_region ; MODIFIER silent_mutation Average:55.336; most accessible tissue: Minghui63 panicle, score: 77.956 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0604742724 NA 6.06E-06 mr1050 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604742724 2.19E-11 3.33E-34 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604742724 7.12E-08 1.03E-22 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604742724 5.86E-10 1.73E-43 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604742724 NA 3.68E-14 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604742724 NA 6.04E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604742724 NA 4.29E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604742724 NA 7.88E-07 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604742724 NA 2.19E-07 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604742724 NA 8.67E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604742724 2.30E-10 3.46E-33 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604742724 5.59E-08 9.34E-20 mr1611 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604742724 2.86E-08 2.19E-35 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604742724 NA 3.25E-11 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604742724 NA 2.66E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604742724 NA 9.82E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604742724 2.28E-13 7.82E-35 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604742724 2.36E-09 2.73E-19 mr1920 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604742724 8.79E-06 2.44E-32 mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604742724 NA 5.73E-18 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604742724 1.37E-10 6.43E-48 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604742724 NA 3.48E-13 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604742724 NA 2.98E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604742724 8.73E-06 1.30E-29 mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604742724 NA 5.36E-16 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604742724 8.58E-07 8.03E-33 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604742724 NA 8.61E-09 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251