\
| Variant ID: vg0604683982 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 4683982 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTTGAAGGATCTAAATGAGTGATCTACAAGTTTAGGGACCAGGATGATACAGTCGAGCAAGTTTGAGGACCTGAACAGTCAATTTGCGAGTTTAGGGACC[G/A]
GGATGACACAGCGGTACAAGTTTAGAGACCGGCGATGGACTTTACTCTATATTTAATAATGAATCAAATGATAGGAAAATAATTAATAATTACTTAAATT
AATTTAAGTAATTATTAATTATTTTCCTATCATTTGATTCATTATTAAATATAGAGTAAAGTCCATCGCCGGTCTCTAAACTTGTACCGCTGTGTCATCC[C/T]
GGTCCCTAAACTCGCAAATTGACTGTTCAGGTCCTCAAACTTGCTCGACTGTATCATCCTGGTCCCTAAACTTGTAGATCACTCATTTAGATCCTTCAAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.50% | 5.40% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 82.90% | 16.50% | 0.53% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 72.60% | 26.50% | 0.91% | 0.00% | NA |
| Tropical Japonica | 504 | 96.40% | 3.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 87.60% | 12.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0604683982 | G -> A | LOC_Os06g09320.1 | upstream_gene_variant ; 3067.0bp to feature; MODIFIER | silent_mutation | Average:42.144; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0604683982 | G -> A | LOC_Os06g09320.2 | upstream_gene_variant ; 2975.0bp to feature; MODIFIER | silent_mutation | Average:42.144; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0604683982 | G -> A | LOC_Os06g09310.1 | downstream_gene_variant ; 3650.0bp to feature; MODIFIER | silent_mutation | Average:42.144; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0604683982 | G -> A | LOC_Os06g09310-LOC_Os06g09320 | intergenic_region ; MODIFIER | silent_mutation | Average:42.144; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0604683982 | NA | 1.44E-10 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604683982 | NA | 1.54E-08 | mr1624 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604683982 | 4.93E-06 | NA | mr1530_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604683982 | NA | 2.43E-09 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |