\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604683982:

Variant ID: vg0604683982 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 4683982
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTGAAGGATCTAAATGAGTGATCTACAAGTTTAGGGACCAGGATGATACAGTCGAGCAAGTTTGAGGACCTGAACAGTCAATTTGCGAGTTTAGGGACC[G/A]
GGATGACACAGCGGTACAAGTTTAGAGACCGGCGATGGACTTTACTCTATATTTAATAATGAATCAAATGATAGGAAAATAATTAATAATTACTTAAATT

Reverse complement sequence

AATTTAAGTAATTATTAATTATTTTCCTATCATTTGATTCATTATTAAATATAGAGTAAAGTCCATCGCCGGTCTCTAAACTTGTACCGCTGTGTCATCC[C/T]
GGTCCCTAAACTCGCAAATTGACTGTTCAGGTCCTCAAACTTGCTCGACTGTATCATCCTGGTCCCTAAACTTGTAGATCACTCATTTAGATCCTTCAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.50% 5.40% 0.17% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 82.90% 16.50% 0.53% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 72.60% 26.50% 0.91% 0.00% NA
Tropical Japonica  504 96.40% 3.60% 0.00% 0.00% NA
Japonica Intermediate  241 87.60% 12.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0604683982 G -> A LOC_Os06g09320.1 upstream_gene_variant ; 3067.0bp to feature; MODIFIER silent_mutation Average:42.144; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0604683982 G -> A LOC_Os06g09320.2 upstream_gene_variant ; 2975.0bp to feature; MODIFIER silent_mutation Average:42.144; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0604683982 G -> A LOC_Os06g09310.1 downstream_gene_variant ; 3650.0bp to feature; MODIFIER silent_mutation Average:42.144; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0604683982 G -> A LOC_Os06g09310-LOC_Os06g09320 intergenic_region ; MODIFIER silent_mutation Average:42.144; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0604683982 NA 1.44E-10 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604683982 NA 1.54E-08 mr1624 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604683982 4.93E-06 NA mr1530_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604683982 NA 2.43E-09 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251