\
| Variant ID: vg0604638830 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 4638830 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 204. )
ATAGTTTCGGTCAGAATTATCCGAAAATTCTTGCATTCGGAAACGAATTCGGATATTTTTTTTCTCGGAAACGAAAACGAAAACAGTAAGGGTACTATCC[G/A]
TCGGAATCGGAAAACGGTCGGAAATTATCCGGAATTTTTTTCGGATATCCGCAGAAATTGAGCAAATTATATAAAAAAACATGTATATATACATAACTTT
AAAGTTATGTATATATACATGTTTTTTTATATAATTTGCTCAATTTCTGCGGATATCCGAAAAAAATTCCGGATAATTTCCGACCGTTTTCCGATTCCGA[C/T]
GGATAGTACCCTTACTGTTTTCGTTTTCGTTTCCGAGAAAAAAAATATCCGAATTCGTTTCCGAATGCAAGAATTTTCGGATAATTCTGACCGAAACTAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.60% | 40.40% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 22.00% | 78.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 1.10% | 98.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 56.30% | 43.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.10% | 4.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 81.70% | 18.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 3.30% | 96.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 44.40% | 55.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 34.90% | 65.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 81.20% | 18.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 47.80% | 52.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0604638830 | G -> A | LOC_Os06g09220.1 | upstream_gene_variant ; 3361.0bp to feature; MODIFIER | silent_mutation | Average:23.527; most accessible tissue: Minghui63 root, score: 38.567 | N | N | N | N |
| vg0604638830 | G -> A | LOC_Os06g09230.2 | downstream_gene_variant ; 1761.0bp to feature; MODIFIER | silent_mutation | Average:23.527; most accessible tissue: Minghui63 root, score: 38.567 | N | N | N | N |
| vg0604638830 | G -> A | LOC_Os06g09220-LOC_Os06g09230 | intergenic_region ; MODIFIER | silent_mutation | Average:23.527; most accessible tissue: Minghui63 root, score: 38.567 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0604638830 | NA | 7.47E-14 | mr1141 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604638830 | NA | 8.52E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604638830 | NA | 5.30E-07 | mr1629 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604638830 | NA | 2.48E-09 | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604638830 | NA | 8.89E-10 | mr1903 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604638830 | NA | 7.36E-11 | mr1907 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604638830 | NA | 9.10E-15 | mr1141_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604638830 | NA | 2.01E-09 | mr1660_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604638830 | NA | 5.27E-06 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604638830 | NA | 1.81E-06 | mr1695_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604638830 | NA | 4.02E-13 | mr1860_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604638830 | NA | 8.76E-07 | mr1860_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |