Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604586643:

Variant ID: vg0604586643 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 4586643
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:

ATAAGAAATCTCTTAAAAAAACTCGCATGCTAACTTGACACGATTGAACTCCTAATTGTAACTTATGATTTTCTAAAAATATATATATCCAAGCGAATTC[T/C]
CACAGCGAATTTTACCTTAACTAAGCCGCATAACAATAATAGATTAAAATAGCCTTCACCCGTTGCAACGCACGGGCATTTTTTCTAGTAAGCTAAAAAG

Reverse complement sequence

CTTTTTAGCTTACTAGAAAAAATGCCCGTGCGTTGCAACGGGTGAAGGCTATTTTAATCTATTATTGTTATGCGGCTTAGTTAAGGTAAAATTCGCTGTG[A/G]
GAATTCGCTTGGATATATATATTTTTAGAAAATCATAAGTTACAATTAGGAGTTCAATCGTGTCAAGTTAGCATGCGAGTTTTTTTAAGAGATTTCTTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.70%	44.60%	0.70%	1.97%	NA
All Indica	2759	85.00%	12.00%	0.65%	2.36%	NA
All Japonica	1512	3.90%	95.70%	0.20%	0.20%	NA
Aus	269	16.70%	71.40%	3.72%	8.18%	NA
Indica I	595	96.30%	3.50%	0.17%	0.00%	NA
Indica II	465	64.70%	35.30%	0.00%	0.00%	NA
Indica III	913	89.50%	4.20%	0.99%	5.37%	NA
Indica Intermediate	786	83.10%	13.90%	1.02%	2.04%	NA
Temperate Japonica	767	4.60%	95.30%	0.00%	0.13%	NA
Tropical Japonica	504	3.40%	96.00%	0.20%	0.40%	NA
Japonica Intermediate	241	2.90%	96.30%	0.83%	0.00%	NA
VI/Aromatic	96	11.50%	88.50%	0.00%	0.00%	NA
Intermediate	90	36.70%	57.80%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0604586643	T -> C	LOC_Os06g09110.1	downstream_gene_variant ; 907.0bp to feature; MODIFIER	silent_mutation	Average:31.786; most accessible tissue: Zhenshan97 root, score: 60.612	N	N	N	N
vg0604586643	T -> C	LOC_Os06g09120.1	downstream_gene_variant ; 1146.0bp to feature; MODIFIER	silent_mutation	Average:31.786; most accessible tissue: Zhenshan97 root, score: 60.612	N	N	N	N
vg0604586643	T -> C	LOC_Os06g09110-LOC_Os06g09120	intergenic_region ; MODIFIER	silent_mutation	Average:31.786; most accessible tissue: Zhenshan97 root, score: 60.612	N	N	N	N
vg0604586643	T -> DEL	N	N	silent_mutation	Average:31.786; most accessible tissue: Zhenshan97 root, score: 60.612	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0604586643	NA	3.00E-15	mr1059	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643	NA	1.03E-15	mr1141	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643	NA	6.92E-17	mr1143	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643	NA	3.56E-16	mr1167	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643	NA	4.62E-15	mr1535	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643	NA	4.21E-12	mr1667	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643	NA	3.74E-15	mr1675	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643	NA	1.19E-13	mr1726	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643	NA	4.44E-12	mr1940	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643	NA	6.00E-15	mr1969	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643	NA	2.20E-06	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643	NA	8.45E-18	mr1995	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643	NA	3.01E-17	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643	NA	6.04E-15	mr1141_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643	NA	3.69E-22	mr1167_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643	NA	4.66E-06	mr1269_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643	NA	2.07E-08	mr1399_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643	NA	6.98E-09	mr1478_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643	NA	1.05E-07	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643	NA	6.78E-14	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643	NA	2.16E-07	mr1677_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643	NA	5.09E-22	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643	NA	2.63E-18	mr1726_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643	NA	3.32E-09	mr1835_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643	NA	5.82E-16	mr1836_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643	NA	2.91E-07	mr1910_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643	NA	2.21E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643	NA	3.09E-16	mr1950_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251