\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604586643:

Variant ID: vg0604586643 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 4586643
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:


ATAAGAAATCTCTTAAAAAAACTCGCATGCTAACTTGACACGATTGAACTCCTAATTGTAACTTATGATTTTCTAAAAATATATATATCCAAGCGAATTC[T/C]
CACAGCGAATTTTACCTTAACTAAGCCGCATAACAATAATAGATTAAAATAGCCTTCACCCGTTGCAACGCACGGGCATTTTTTCTAGTAAGCTAAAAAG

Reverse complement sequence

CTTTTTAGCTTACTAGAAAAAATGCCCGTGCGTTGCAACGGGTGAAGGCTATTTTAATCTATTATTGTTATGCGGCTTAGTTAAGGTAAAATTCGCTGTG[A/G]
GAATTCGCTTGGATATATATATTTTTAGAAAATCATAAGTTACAATTAGGAGTTCAATCGTGTCAAGTTAGCATGCGAGTTTTTTTAAGAGATTTCTTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.70% 44.60% 0.70% 1.97% NA
All Indica  2759 85.00% 12.00% 0.65% 2.36% NA
All Japonica  1512 3.90% 95.70% 0.20% 0.20% NA
Aus  269 16.70% 71.40% 3.72% 8.18% NA
Indica I  595 96.30% 3.50% 0.17% 0.00% NA
Indica II  465 64.70% 35.30% 0.00% 0.00% NA
Indica III  913 89.50% 4.20% 0.99% 5.37% NA
Indica Intermediate  786 83.10% 13.90% 1.02% 2.04% NA
Temperate Japonica  767 4.60% 95.30% 0.00% 0.13% NA
Tropical Japonica  504 3.40% 96.00% 0.20% 0.40% NA
Japonica Intermediate  241 2.90% 96.30% 0.83% 0.00% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 36.70% 57.80% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0604586643 T -> C LOC_Os06g09110.1 downstream_gene_variant ; 907.0bp to feature; MODIFIER silent_mutation Average:31.786; most accessible tissue: Zhenshan97 root, score: 60.612 N N N N
vg0604586643 T -> C LOC_Os06g09120.1 downstream_gene_variant ; 1146.0bp to feature; MODIFIER silent_mutation Average:31.786; most accessible tissue: Zhenshan97 root, score: 60.612 N N N N
vg0604586643 T -> C LOC_Os06g09110-LOC_Os06g09120 intergenic_region ; MODIFIER silent_mutation Average:31.786; most accessible tissue: Zhenshan97 root, score: 60.612 N N N N
vg0604586643 T -> DEL N N silent_mutation Average:31.786; most accessible tissue: Zhenshan97 root, score: 60.612 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0604586643 NA 3.00E-15 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643 NA 1.03E-15 mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643 NA 6.92E-17 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643 NA 3.56E-16 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643 NA 4.62E-15 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643 NA 4.21E-12 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643 NA 3.74E-15 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643 NA 1.19E-13 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643 NA 4.44E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643 NA 6.00E-15 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643 NA 2.20E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643 NA 8.45E-18 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643 NA 3.01E-17 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643 NA 6.04E-15 mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643 NA 3.69E-22 mr1167_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643 NA 4.66E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643 NA 2.07E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643 NA 6.98E-09 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643 NA 1.05E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643 NA 6.78E-14 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643 NA 2.16E-07 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643 NA 5.09E-22 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643 NA 2.63E-18 mr1726_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643 NA 3.32E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643 NA 5.82E-16 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643 NA 2.91E-07 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643 NA 2.21E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604586643 NA 3.09E-16 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251