\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604585933:

Variant ID: vg0604585933 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 4585933
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.12, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


AGTGGAAATATTTTCAATTTTTATAATAGTAGAGATAAGTAGTAGTATATGTATACAGACACTAAGTAATTAAGTAGAAACTACTAGCTAGGATACTCCT[A/G]
CGCGACCAATACACGGTTTATACACTGTCTAGTTGACAGTTTTTTTTGTACTATATATGTATTTGGTAACGTAGCCAGCCAGTACTCAGAAAATTCAGAG

Reverse complement sequence

CTCTGAATTTTCTGAGTACTGGCTGGCTACGTTACCAAATACATATATAGTACAAAAAAAACTGTCAACTAGACAGTGTATAAACCGTGTATTGGTCGCG[T/C]
AGGAGTATCCTAGCTAGTAGTTTCTACTTAATTACTTAGTGTCTGTATACATATACTACTACTTATCTCTACTATTATAAAAATTGAAAATATTTCCACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.30% 43.90% 0.80% 1.02% NA
All Indica  2759 86.00% 11.10% 1.12% 1.74% NA
All Japonica  1512 4.20% 95.50% 0.26% 0.00% NA
Aus  269 28.60% 71.40% 0.00% 0.00% NA
Indica I  595 96.30% 3.50% 0.17% 0.00% NA
Indica II  465 65.20% 34.40% 0.43% 0.00% NA
Indica III  913 90.60% 2.30% 2.30% 4.82% NA
Indica Intermediate  786 85.40% 13.20% 0.89% 0.51% NA
Temperate Japonica  767 4.70% 95.30% 0.00% 0.00% NA
Tropical Japonica  504 4.00% 95.60% 0.40% 0.00% NA
Japonica Intermediate  241 3.30% 95.90% 0.83% 0.00% NA
VI/Aromatic  96 11.50% 86.50% 2.08% 0.00% NA
Intermediate  90 42.20% 56.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0604585933 A -> G LOC_Os06g09110.1 downstream_gene_variant ; 197.0bp to feature; MODIFIER silent_mutation Average:45.245; most accessible tissue: Callus, score: 74.594 N N N N
vg0604585933 A -> G LOC_Os06g09120.1 downstream_gene_variant ; 1856.0bp to feature; MODIFIER silent_mutation Average:45.245; most accessible tissue: Callus, score: 74.594 N N N N
vg0604585933 A -> G LOC_Os06g09110-LOC_Os06g09120 intergenic_region ; MODIFIER silent_mutation Average:45.245; most accessible tissue: Callus, score: 74.594 N N N N
vg0604585933 A -> DEL N N silent_mutation Average:45.245; most accessible tissue: Callus, score: 74.594 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0604585933 NA 2.27E-14 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604585933 NA 4.14E-17 mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604585933 NA 9.70E-16 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604585933 NA 2.45E-15 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604585933 NA 6.35E-12 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604585933 NA 4.49E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604585933 NA 1.98E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604585933 NA 2.79E-16 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604585933 NA 5.90E-18 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604585933 NA 1.33E-16 mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604585933 NA 4.85E-21 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604585933 NA 9.29E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604585933 NA 5.67E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604585933 NA 4.77E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604585933 NA 9.41E-15 mr1667_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604585933 NA 4.55E-07 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604585933 NA 1.55E-17 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604585933 NA 9.09E-16 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604585933 NA 9.38E-09 mr1860_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604585933 NA 6.04E-07 mr1910_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604585933 NA 3.41E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604585933 NA 2.23E-15 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251