\
| Variant ID: vg0604294396 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 4294396 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 68. )
CGTACTCATCCAGAAGCATTTCATAGCTGTCAGCCACAGAGTGACCCTGATCTGCCATCTCTTAAAATGCACACCGGTGAATTTATCCGGCCTCAGTGCA[C/T]
CGGCAAAACCAGCCATAGTAAAATCACAGTGCCTATAATAAGGTTTTTTGGATTGTTGAGATTATGGGCATATAATGATTTAATTTATTCCATAAATAAA
TTTATTTATGGAATAAATTAAATCATTATATGCCCATAATCTCAACAATCCAAAAAACCTTATTATAGGCACTGTGATTTTACTATGGCTGGTTTTGCCG[G/A]
TGCACTGAGGCCGGATAAATTCACCGGTGTGCATTTTAAGAGATGGCAGATCAGGGTCACTCTGTGGCTGACAGCTATGAAATGCTTCTGGATGAGTACG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 12.70% | 0.60% | 1.59% | 85.12% | NA |
| All Indica | 2759 | 1.10% | 0.80% | 1.09% | 96.96% | NA |
| All Japonica | 1512 | 37.20% | 0.10% | 2.05% | 60.65% | NA |
| Aus | 269 | 0.00% | 0.40% | 1.86% | 97.77% | NA |
| Indica I | 595 | 0.70% | 1.00% | 0.17% | 98.15% | NA |
| Indica II | 465 | 1.10% | 1.30% | 0.43% | 97.20% | NA |
| Indica III | 913 | 0.30% | 0.10% | 0.99% | 98.58% | NA |
| Indica Intermediate | 786 | 2.40% | 1.30% | 2.29% | 94.02% | NA |
| Temperate Japonica | 767 | 63.80% | 0.00% | 2.61% | 33.64% | NA |
| Tropical Japonica | 504 | 3.20% | 0.00% | 1.39% | 95.44% | NA |
| Japonica Intermediate | 241 | 24.10% | 0.40% | 1.66% | 73.86% | NA |
| VI/Aromatic | 96 | 0.00% | 1.00% | 6.25% | 92.71% | NA |
| Intermediate | 90 | 8.90% | 0.00% | 3.33% | 87.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0604294396 | C -> T | LOC_Os06g08630.1 | missense_variant ; p.Gly6Asp; MODERATE | nonsynonymous_codon ; G6D | Average:5.011; most accessible tissue: Zhenshan97 young leaf, score: 7.417 | unknown | unknown | TOLERATED | 1.00 |
| vg0604294396 | C -> DEL | LOC_Os06g08630.1 | N | frameshift_variant | Average:5.011; most accessible tissue: Zhenshan97 young leaf, score: 7.417 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0604294396 | 4.28E-14 | 3.83E-35 | mr1115 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604294396 | 2.92E-12 | 3.65E-29 | mr1115 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604294396 | 1.90E-27 | 4.34E-62 | mr1137 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604294396 | 7.39E-13 | 2.00E-21 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604294396 | NA | 5.24E-11 | mr1241 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604294396 | NA | 9.66E-09 | mr1552 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604294396 | NA | 3.03E-06 | mr1576 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604294396 | 1.41E-09 | 2.24E-30 | mr1611 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604294396 | 8.94E-07 | 7.64E-19 | mr1611 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604294396 | 2.91E-23 | 3.17E-51 | mr1617 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604294396 | 4.06E-11 | 2.47E-16 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604294396 | 8.43E-12 | 6.14E-32 | mr1920 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604294396 | 5.36E-08 | 3.39E-18 | mr1920 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604294396 | 1.10E-12 | 2.40E-36 | mr1115_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604294396 | 1.51E-10 | 7.43E-28 | mr1115_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604294396 | 1.76E-23 | 9.92E-61 | mr1137_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604294396 | 3.00E-11 | 5.40E-18 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604294396 | 3.42E-08 | NA | mr1241_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604294396 | NA | 4.10E-15 | mr1241_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604294396 | 2.93E-08 | 1.06E-29 | mr1611_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604294396 | 1.94E-07 | 3.62E-20 | mr1611_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604294396 | 5.69E-13 | 1.47E-38 | mr1617_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604294396 | 6.38E-07 | 8.50E-11 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604294396 | NA | 2.87E-06 | mr1680_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |