Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0604247093:

Variant ID: vg0604247093 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 4247093
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGCACTAGTTAATTTACCTATATATATATAAAGGAAATAATATATATATATAATATATTGAAACATACTCGTAAAATGGACGATTTACAATATATTACC[A/C]
CTACTTATAGAGTTGTAGGTAGCATAAACATTCCATATAGCCTTTGAGGCTTTGGTGTAGGGTGTATCCAACCGGAGCTTTGCCTTGTCGGCTCCGGGAA

Reverse complement sequence

TTCCCGGAGCCGACAAGGCAAAGCTCCGGTTGGATACACCCTACACCAAAGCCTCAAAGGCTATATGGAATGTTTATGCTACCTACAACTCTATAAGTAG[T/G]
GGTAATATATTGTAAATCGTCCATTTTACGAGTATGTTTCAATATATTATATATATATATTATTTCCTTTATATATATATAGGTAAATTAACTAGTGCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.30% 10.70% 0.00% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 67.50% 32.50% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.90% 0.00% 0.00% NA
Temperate Japonica  767 45.50% 54.50% 0.00% 0.00% NA
Tropical Japonica  504 97.20% 2.80% 0.00% 0.00% NA
Japonica Intermediate  241 75.10% 24.90% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0604247093 A -> C LOC_Os06g08560.1 upstream_gene_variant ; 3635.0bp to feature; MODIFIER silent_mutation Average:60.02; most accessible tissue: Callus, score: 92.942 N N N N
vg0604247093 A -> C LOC_Os06g08550-LOC_Os06g08560 intergenic_region ; MODIFIER silent_mutation Average:60.02; most accessible tissue: Callus, score: 92.942 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0604247093 2.81E-07 NA Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0604247093 1.23E-14 1.82E-34 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604247093 4.24E-09 5.76E-19 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604247093 7.10E-28 1.78E-63 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604247093 1.18E-15 1.44E-28 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604247093 NA 4.66E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604247093 2.70E-11 2.41E-30 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604247093 1.44E-07 1.74E-15 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604247093 4.65E-25 8.65E-53 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604247093 3.74E-15 6.61E-24 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604247093 4.54E-15 1.46E-33 mr1920 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604247093 4.24E-09 4.90E-16 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604247093 7.73E-12 3.89E-34 mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604247093 2.39E-07 1.81E-17 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604247093 6.46E-30 5.00E-70 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604247093 6.63E-15 2.06E-28 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604247093 2.72E-07 NA mr1241_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604247093 4.69E-10 5.82E-30 mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604247093 2.39E-07 7.91E-16 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604247093 1.18E-16 1.28E-42 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604247093 2.78E-09 2.71E-16 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251