Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604208452:

Variant ID: vg0604208452 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 4208452
Reference Allele: A	Alternative Allele: C,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTTTTGTAGTACTCTTATGTTCTAAAATACCCCTCCATCCCAAAAAGAATAAATCAAACTCAGAGTTTGAATTTGGACACATATTGTCTATATTCAAAC[A/C,T]
TAGTATTTGATTTTTTTTAACAGAGTAGTATAATAAATTTTTAGTGGATGTGACACATTCTAGTATTATGAATCTGGTTAGTAAGCTTATCTAAATTGTA

Reverse complement sequence

TACAATTTAGATAAGCTTACTAACCAGATTCATAATACTAGAATGTGTCACATCCACTAAAAATTTATTATACTACTCTGTTAAAAAAAATCAAATACTA[T/G,A]
GTTTGAATATAGACAATATGTGTCCAAATTCAAACTCTGAGTTTGATTTATTCTTTTTGGGATGGAGGGGTATTTTAGAACATAAGAGTACTACAAAACA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.50%	22.70%	0.08%	0.00%	T: 0.76%
All Indica	2759	97.50%	1.20%	0.00%	0.00%	T: 1.30%
All Japonica	1512	35.30%	64.50%	0.26%	0.00%	NA
Aus	269	97.40%	2.60%	0.00%	0.00%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	96.80%	2.60%	0.00%	0.00%	T: 0.65%
Indica III	913	97.70%	0.50%	0.00%	0.00%	T: 1.75%
Indica Intermediate	786	96.30%	1.50%	0.00%	0.00%	T: 2.16%
Temperate Japonica	767	2.90%	96.70%	0.39%	0.00%	NA
Tropical Japonica	504	83.90%	16.10%	0.00%	0.00%	NA
Japonica Intermediate	241	36.50%	63.10%	0.41%	0.00%	NA
VI/Aromatic	96	57.30%	42.70%	0.00%	0.00%	NA
Intermediate	90	83.30%	16.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0604208452	A -> C	LOC_Os06g08520.1	upstream_gene_variant ; 1457.0bp to feature; MODIFIER	silent_mutation	Average:66.066; most accessible tissue: Callus, score: 89.458	N	N	N	N
vg0604208452	A -> C	LOC_Os06g08530.1	downstream_gene_variant ; 4667.0bp to feature; MODIFIER	silent_mutation	Average:66.066; most accessible tissue: Callus, score: 89.458	N	N	N	N
vg0604208452	A -> C	LOC_Os06g08530.3	downstream_gene_variant ; 4667.0bp to feature; MODIFIER	silent_mutation	Average:66.066; most accessible tissue: Callus, score: 89.458	N	N	N	N
vg0604208452	A -> C	LOC_Os06g08530.2	downstream_gene_variant ; 4667.0bp to feature; MODIFIER	silent_mutation	Average:66.066; most accessible tissue: Callus, score: 89.458	N	N	N	N
vg0604208452	A -> C	LOC_Os06g08530.4	downstream_gene_variant ; 4667.0bp to feature; MODIFIER	silent_mutation	Average:66.066; most accessible tissue: Callus, score: 89.458	N	N	N	N
vg0604208452	A -> C	LOC_Os06g08530.5	downstream_gene_variant ; 4667.0bp to feature; MODIFIER	silent_mutation	Average:66.066; most accessible tissue: Callus, score: 89.458	N	N	N	N
vg0604208452	A -> C	LOC_Os06g08520-LOC_Os06g08530	intergenic_region ; MODIFIER	silent_mutation	Average:66.066; most accessible tissue: Callus, score: 89.458	N	N	N	N
vg0604208452	A -> T	LOC_Os06g08520.1	upstream_gene_variant ; 1457.0bp to feature; MODIFIER	silent_mutation	Average:66.066; most accessible tissue: Callus, score: 89.458	N	N	N	N
vg0604208452	A -> T	LOC_Os06g08530.1	downstream_gene_variant ; 4667.0bp to feature; MODIFIER	silent_mutation	Average:66.066; most accessible tissue: Callus, score: 89.458	N	N	N	N
vg0604208452	A -> T	LOC_Os06g08530.3	downstream_gene_variant ; 4667.0bp to feature; MODIFIER	silent_mutation	Average:66.066; most accessible tissue: Callus, score: 89.458	N	N	N	N
vg0604208452	A -> T	LOC_Os06g08530.2	downstream_gene_variant ; 4667.0bp to feature; MODIFIER	silent_mutation	Average:66.066; most accessible tissue: Callus, score: 89.458	N	N	N	N
vg0604208452	A -> T	LOC_Os06g08530.4	downstream_gene_variant ; 4667.0bp to feature; MODIFIER	silent_mutation	Average:66.066; most accessible tissue: Callus, score: 89.458	N	N	N	N
vg0604208452	A -> T	LOC_Os06g08530.5	downstream_gene_variant ; 4667.0bp to feature; MODIFIER	silent_mutation	Average:66.066; most accessible tissue: Callus, score: 89.458	N	N	N	N
vg0604208452	A -> T	LOC_Os06g08520-LOC_Os06g08530	intergenic_region ; MODIFIER	silent_mutation	Average:66.066; most accessible tissue: Callus, score: 89.458	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0604208452	NA	8.76E-06	mr1050	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452	5.38E-14	4.89E-32	mr1115	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452	1.85E-08	1.22E-23	mr1115	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452	NA	8.38E-31	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452	9.38E-09	2.89E-63	mr1241	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452	NA	5.18E-12	mr1241	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452	1.65E-08	4.35E-28	mr1611	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452	NA	1.68E-16	mr1611	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452	NA	2.25E-06	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452	NA	7.70E-13	mr1740	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452	5.79E-12	8.71E-31	mr1920	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452	1.09E-06	5.83E-16	mr1920	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452	1.06E-08	2.33E-31	mr1115_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452	NA	6.93E-19	mr1115_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452	1.61E-10	1.06E-76	mr1241_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452	NA	1.79E-15	mr1241_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452	NA	4.36E-06	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452	NA	6.44E-27	mr1611_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452	NA	2.52E-13	mr1611_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452	NA	2.55E-07	mr1629_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452	NA	7.87E-29	mr1789_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452	NA	5.04E-06	mr1793_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251