\
| Variant ID: vg0604208452 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 4208452 |
| Reference Allele: A | Alternative Allele: C,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGTTTTGTAGTACTCTTATGTTCTAAAATACCCCTCCATCCCAAAAAGAATAAATCAAACTCAGAGTTTGAATTTGGACACATATTGTCTATATTCAAAC[A/C,T]
TAGTATTTGATTTTTTTTAACAGAGTAGTATAATAAATTTTTAGTGGATGTGACACATTCTAGTATTATGAATCTGGTTAGTAAGCTTATCTAAATTGTA
TACAATTTAGATAAGCTTACTAACCAGATTCATAATACTAGAATGTGTCACATCCACTAAAAATTTATTATACTACTCTGTTAAAAAAAATCAAATACTA[T/G,A]
GTTTGAATATAGACAATATGTGTCCAAATTCAAACTCTGAGTTTGATTTATTCTTTTTGGGATGGAGGGGTATTTTAGAACATAAGAGTACTACAAAACA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.50% | 22.70% | 0.08% | 0.00% | T: 0.76% |
| All Indica | 2759 | 97.50% | 1.20% | 0.00% | 0.00% | T: 1.30% |
| All Japonica | 1512 | 35.30% | 64.50% | 0.26% | 0.00% | NA |
| Aus | 269 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.80% | 2.60% | 0.00% | 0.00% | T: 0.65% |
| Indica III | 913 | 97.70% | 0.50% | 0.00% | 0.00% | T: 1.75% |
| Indica Intermediate | 786 | 96.30% | 1.50% | 0.00% | 0.00% | T: 2.16% |
| Temperate Japonica | 767 | 2.90% | 96.70% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 83.90% | 16.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 36.50% | 63.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 57.30% | 42.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0604208452 | A -> C | LOC_Os06g08520.1 | upstream_gene_variant ; 1457.0bp to feature; MODIFIER | silent_mutation | Average:66.066; most accessible tissue: Callus, score: 89.458 | N | N | N | N |
| vg0604208452 | A -> C | LOC_Os06g08530.1 | downstream_gene_variant ; 4667.0bp to feature; MODIFIER | silent_mutation | Average:66.066; most accessible tissue: Callus, score: 89.458 | N | N | N | N |
| vg0604208452 | A -> C | LOC_Os06g08530.3 | downstream_gene_variant ; 4667.0bp to feature; MODIFIER | silent_mutation | Average:66.066; most accessible tissue: Callus, score: 89.458 | N | N | N | N |
| vg0604208452 | A -> C | LOC_Os06g08530.2 | downstream_gene_variant ; 4667.0bp to feature; MODIFIER | silent_mutation | Average:66.066; most accessible tissue: Callus, score: 89.458 | N | N | N | N |
| vg0604208452 | A -> C | LOC_Os06g08530.4 | downstream_gene_variant ; 4667.0bp to feature; MODIFIER | silent_mutation | Average:66.066; most accessible tissue: Callus, score: 89.458 | N | N | N | N |
| vg0604208452 | A -> C | LOC_Os06g08530.5 | downstream_gene_variant ; 4667.0bp to feature; MODIFIER | silent_mutation | Average:66.066; most accessible tissue: Callus, score: 89.458 | N | N | N | N |
| vg0604208452 | A -> C | LOC_Os06g08520-LOC_Os06g08530 | intergenic_region ; MODIFIER | silent_mutation | Average:66.066; most accessible tissue: Callus, score: 89.458 | N | N | N | N |
| vg0604208452 | A -> T | LOC_Os06g08520.1 | upstream_gene_variant ; 1457.0bp to feature; MODIFIER | silent_mutation | Average:66.066; most accessible tissue: Callus, score: 89.458 | N | N | N | N |
| vg0604208452 | A -> T | LOC_Os06g08530.1 | downstream_gene_variant ; 4667.0bp to feature; MODIFIER | silent_mutation | Average:66.066; most accessible tissue: Callus, score: 89.458 | N | N | N | N |
| vg0604208452 | A -> T | LOC_Os06g08530.3 | downstream_gene_variant ; 4667.0bp to feature; MODIFIER | silent_mutation | Average:66.066; most accessible tissue: Callus, score: 89.458 | N | N | N | N |
| vg0604208452 | A -> T | LOC_Os06g08530.2 | downstream_gene_variant ; 4667.0bp to feature; MODIFIER | silent_mutation | Average:66.066; most accessible tissue: Callus, score: 89.458 | N | N | N | N |
| vg0604208452 | A -> T | LOC_Os06g08530.4 | downstream_gene_variant ; 4667.0bp to feature; MODIFIER | silent_mutation | Average:66.066; most accessible tissue: Callus, score: 89.458 | N | N | N | N |
| vg0604208452 | A -> T | LOC_Os06g08530.5 | downstream_gene_variant ; 4667.0bp to feature; MODIFIER | silent_mutation | Average:66.066; most accessible tissue: Callus, score: 89.458 | N | N | N | N |
| vg0604208452 | A -> T | LOC_Os06g08520-LOC_Os06g08530 | intergenic_region ; MODIFIER | silent_mutation | Average:66.066; most accessible tissue: Callus, score: 89.458 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0604208452 | NA | 8.76E-06 | mr1050 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604208452 | 5.38E-14 | 4.89E-32 | mr1115 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604208452 | 1.85E-08 | 1.22E-23 | mr1115 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604208452 | NA | 8.38E-31 | mr1137 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604208452 | 9.38E-09 | 2.89E-63 | mr1241 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604208452 | NA | 5.18E-12 | mr1241 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604208452 | 1.65E-08 | 4.35E-28 | mr1611 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604208452 | NA | 1.68E-16 | mr1611 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604208452 | NA | 2.25E-06 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604208452 | NA | 7.70E-13 | mr1740 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604208452 | 5.79E-12 | 8.71E-31 | mr1920 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604208452 | 1.09E-06 | 5.83E-16 | mr1920 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604208452 | 1.06E-08 | 2.33E-31 | mr1115_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604208452 | NA | 6.93E-19 | mr1115_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604208452 | 1.61E-10 | 1.06E-76 | mr1241_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604208452 | NA | 1.79E-15 | mr1241_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604208452 | NA | 4.36E-06 | mr1363_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604208452 | NA | 6.44E-27 | mr1611_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604208452 | NA | 2.52E-13 | mr1611_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604208452 | NA | 2.55E-07 | mr1629_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604208452 | NA | 7.87E-29 | mr1789_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0604208452 | NA | 5.04E-06 | mr1793_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |