\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0604208452:

Variant ID: vg0604208452 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 4208452
Reference Allele: AAlternative Allele: C,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTTTTGTAGTACTCTTATGTTCTAAAATACCCCTCCATCCCAAAAAGAATAAATCAAACTCAGAGTTTGAATTTGGACACATATTGTCTATATTCAAAC[A/C,T]
TAGTATTTGATTTTTTTTAACAGAGTAGTATAATAAATTTTTAGTGGATGTGACACATTCTAGTATTATGAATCTGGTTAGTAAGCTTATCTAAATTGTA

Reverse complement sequence

TACAATTTAGATAAGCTTACTAACCAGATTCATAATACTAGAATGTGTCACATCCACTAAAAATTTATTATACTACTCTGTTAAAAAAAATCAAATACTA[T/G,A]
GTTTGAATATAGACAATATGTGTCCAAATTCAAACTCTGAGTTTGATTTATTCTTTTTGGGATGGAGGGGTATTTTAGAACATAAGAGTACTACAAAACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.50% 22.70% 0.08% 0.00% T: 0.76%
All Indica  2759 97.50% 1.20% 0.00% 0.00% T: 1.30%
All Japonica  1512 35.30% 64.50% 0.26% 0.00% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 96.80% 2.60% 0.00% 0.00% T: 0.65%
Indica III  913 97.70% 0.50% 0.00% 0.00% T: 1.75%
Indica Intermediate  786 96.30% 1.50% 0.00% 0.00% T: 2.16%
Temperate Japonica  767 2.90% 96.70% 0.39% 0.00% NA
Tropical Japonica  504 83.90% 16.10% 0.00% 0.00% NA
Japonica Intermediate  241 36.50% 63.10% 0.41% 0.00% NA
VI/Aromatic  96 57.30% 42.70% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0604208452 A -> C LOC_Os06g08520.1 upstream_gene_variant ; 1457.0bp to feature; MODIFIER silent_mutation Average:66.066; most accessible tissue: Callus, score: 89.458 N N N N
vg0604208452 A -> C LOC_Os06g08530.1 downstream_gene_variant ; 4667.0bp to feature; MODIFIER silent_mutation Average:66.066; most accessible tissue: Callus, score: 89.458 N N N N
vg0604208452 A -> C LOC_Os06g08530.3 downstream_gene_variant ; 4667.0bp to feature; MODIFIER silent_mutation Average:66.066; most accessible tissue: Callus, score: 89.458 N N N N
vg0604208452 A -> C LOC_Os06g08530.2 downstream_gene_variant ; 4667.0bp to feature; MODIFIER silent_mutation Average:66.066; most accessible tissue: Callus, score: 89.458 N N N N
vg0604208452 A -> C LOC_Os06g08530.4 downstream_gene_variant ; 4667.0bp to feature; MODIFIER silent_mutation Average:66.066; most accessible tissue: Callus, score: 89.458 N N N N
vg0604208452 A -> C LOC_Os06g08530.5 downstream_gene_variant ; 4667.0bp to feature; MODIFIER silent_mutation Average:66.066; most accessible tissue: Callus, score: 89.458 N N N N
vg0604208452 A -> C LOC_Os06g08520-LOC_Os06g08530 intergenic_region ; MODIFIER silent_mutation Average:66.066; most accessible tissue: Callus, score: 89.458 N N N N
vg0604208452 A -> T LOC_Os06g08520.1 upstream_gene_variant ; 1457.0bp to feature; MODIFIER silent_mutation Average:66.066; most accessible tissue: Callus, score: 89.458 N N N N
vg0604208452 A -> T LOC_Os06g08530.1 downstream_gene_variant ; 4667.0bp to feature; MODIFIER silent_mutation Average:66.066; most accessible tissue: Callus, score: 89.458 N N N N
vg0604208452 A -> T LOC_Os06g08530.3 downstream_gene_variant ; 4667.0bp to feature; MODIFIER silent_mutation Average:66.066; most accessible tissue: Callus, score: 89.458 N N N N
vg0604208452 A -> T LOC_Os06g08530.2 downstream_gene_variant ; 4667.0bp to feature; MODIFIER silent_mutation Average:66.066; most accessible tissue: Callus, score: 89.458 N N N N
vg0604208452 A -> T LOC_Os06g08530.4 downstream_gene_variant ; 4667.0bp to feature; MODIFIER silent_mutation Average:66.066; most accessible tissue: Callus, score: 89.458 N N N N
vg0604208452 A -> T LOC_Os06g08530.5 downstream_gene_variant ; 4667.0bp to feature; MODIFIER silent_mutation Average:66.066; most accessible tissue: Callus, score: 89.458 N N N N
vg0604208452 A -> T LOC_Os06g08520-LOC_Os06g08530 intergenic_region ; MODIFIER silent_mutation Average:66.066; most accessible tissue: Callus, score: 89.458 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0604208452 NA 8.76E-06 mr1050 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452 5.38E-14 4.89E-32 mr1115 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452 1.85E-08 1.22E-23 mr1115 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452 NA 8.38E-31 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452 9.38E-09 2.89E-63 mr1241 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452 NA 5.18E-12 mr1241 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452 1.65E-08 4.35E-28 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452 NA 1.68E-16 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452 NA 2.25E-06 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452 NA 7.70E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452 5.79E-12 8.71E-31 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452 1.09E-06 5.83E-16 mr1920 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452 1.06E-08 2.33E-31 mr1115_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452 NA 6.93E-19 mr1115_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452 1.61E-10 1.06E-76 mr1241_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452 NA 1.79E-15 mr1241_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452 NA 4.36E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452 NA 6.44E-27 mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452 NA 2.52E-13 mr1611_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452 NA 2.55E-07 mr1629_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452 NA 7.87E-29 mr1789_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0604208452 NA 5.04E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251