Variant ID: vg0603584467 (JBrowse) | Variation Type: SNP |
Chromosome: chr06 | Position: 3584467 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AAGTATAGATGGTCAAATAGGCCATTGGGCCCGAGCACGACCAAACACGGCCTAATCAACACGCCGAGCCGTGTCGTGCCTGTCCATGGGCTATACCAAC[A/G]
GTCTAGGAACAGCCTAATAGGTTCGTGTCGTACACTCGTGCCAGGCCGAGCCAAAGGCATGACAAGTATATCGTATTCTTTCTTGGAATAAATGTAATTT
AAATTACATTTATTCCAAGAAAGAATACGATATACTTGTCATGCCTTTGGCTCGGCCTGGCACGAGTGTACGACACGAACCTATTAGGCTGTTCCTAGAC[T/C]
GTTGGTATAGCCCATGGACAGGCACGACACGGCTCGGCGTGTTGATTAGGCCGTGTTTGGTCGTGCTCGGGCCCAATGGCCTATTTGACCATCTATACTT
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 89.90% | 9.40% | 0.70% | 0.00% | NA |
All Indica | 2759 | 97.80% | 2.00% | 0.18% | 0.00% | NA |
All Japonica | 1512 | 73.70% | 24.50% | 1.79% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
Indica II | 465 | 95.50% | 4.10% | 0.43% | 0.00% | NA |
Indica III | 913 | 99.30% | 0.50% | 0.11% | 0.00% | NA |
Indica Intermediate | 786 | 95.80% | 4.10% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 96.20% | 1.20% | 2.61% | 0.00% | NA |
Tropical Japonica | 504 | 30.40% | 68.70% | 0.99% | 0.00% | NA |
Japonica Intermediate | 241 | 92.50% | 6.60% | 0.83% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 81.10% | 17.80% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0603584467 | A -> G | LOC_Os06g07440.1 | upstream_gene_variant ; 4826.0bp to feature; MODIFIER | silent_mutation | Average:68.896; most accessible tissue: Callus, score: 90.098 | N | N | N | N |
vg0603584467 | A -> G | LOC_Os06g07460.1 | upstream_gene_variant ; 1034.0bp to feature; MODIFIER | silent_mutation | Average:68.896; most accessible tissue: Callus, score: 90.098 | N | N | N | N |
vg0603584467 | A -> G | LOC_Os06g07470.1 | upstream_gene_variant ; 750.0bp to feature; MODIFIER | silent_mutation | Average:68.896; most accessible tissue: Callus, score: 90.098 | N | N | N | N |
vg0603584467 | A -> G | LOC_Os06g07450.1 | downstream_gene_variant ; 3111.0bp to feature; MODIFIER | silent_mutation | Average:68.896; most accessible tissue: Callus, score: 90.098 | N | N | N | N |
vg0603584467 | A -> G | LOC_Os06g07474.1 | downstream_gene_variant ; 3750.0bp to feature; MODIFIER | silent_mutation | Average:68.896; most accessible tissue: Callus, score: 90.098 | N | N | N | N |
vg0603584467 | A -> G | LOC_Os06g07474.2 | downstream_gene_variant ; 3750.0bp to feature; MODIFIER | silent_mutation | Average:68.896; most accessible tissue: Callus, score: 90.098 | N | N | N | N |
vg0603584467 | A -> G | LOC_Os06g07460-LOC_Os06g07470 | intergenic_region ; MODIFIER | silent_mutation | Average:68.896; most accessible tissue: Callus, score: 90.098 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0603584467 | NA | 6.45E-07 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0603584467 | NA | 2.18E-07 | mr1551 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0603584467 | NA | 5.79E-08 | mr1552 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0603584467 | NA | 3.50E-06 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0603584467 | 8.96E-07 | 1.46E-14 | mr1115_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0603584467 | NA | 1.54E-12 | mr1241_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0603584467 | NA | 1.33E-06 | mr1423_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0603584467 | NA | 2.63E-15 | mr1539_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0603584467 | 4.18E-06 | 6.85E-12 | mr1611_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0603584467 | NA | 9.41E-09 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |