Variant ID: vg0603483013 (JBrowse) | Variation Type: SNP |
Chromosome: chr06 | Position: 3483013 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TATATTTCATGTGGGATTGGATTCAAATGAATTGGATTTGATTTTACTGTTTCTTTTAGCTAATCATGGCATCAAGCTATCAACATGGTCCGAATATTTA[A/G]
TATTTGAACTATAAATTAAATTAGTAATTAACCTTCCCTTTGTTTGGGTTTGCTTTCTTTGTAATTATTTACGGTTTGGCAAGCAATAGCAATCATAACA
TGTTATGATTGCTATTGCTTGCCAAACCGTAAATAATTACAAAGAAAGCAAACCCAAACAAAGGGAAGGTTAATTACTAATTTAATTTATAGTTCAAATA[T/C]
TAAATATTCGGACCATGTTGATAGCTTGATGCCATGATTAGCTAAAAGAAACAGTAAAATCAAATCCAATTCATTTGAATCCAATCCCACATGAAATATA
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 64.40% | 2.90% | 7.64% | 25.03% | NA |
All Indica | 2759 | 74.30% | 0.30% | 3.23% | 22.22% | NA |
All Japonica | 1512 | 38.20% | 8.40% | 17.39% | 35.98% | NA |
Aus | 269 | 98.10% | 0.40% | 0.37% | 1.12% | NA |
Indica I | 595 | 64.70% | 0.00% | 2.86% | 32.44% | NA |
Indica II | 465 | 79.60% | 0.60% | 2.15% | 17.63% | NA |
Indica III | 913 | 77.30% | 0.30% | 3.83% | 18.51% | NA |
Indica Intermediate | 786 | 74.80% | 0.30% | 3.44% | 21.50% | NA |
Temperate Japonica | 767 | 56.50% | 0.50% | 5.35% | 37.68% | NA |
Tropical Japonica | 504 | 17.70% | 22.20% | 31.75% | 28.37% | NA |
Japonica Intermediate | 241 | 23.20% | 4.60% | 25.73% | 46.47% | NA |
VI/Aromatic | 96 | 91.70% | 0.00% | 7.29% | 1.04% | NA |
Intermediate | 90 | 73.30% | 1.10% | 1.11% | 24.44% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0603483013 | A -> G | LOC_Os06g07270.1 | downstream_gene_variant ; 612.0bp to feature; MODIFIER | silent_mutation | Average:18.111; most accessible tissue: Callus, score: 41.206 | N | N | N | N |
vg0603483013 | A -> G | LOC_Os06g07260-LOC_Os06g07270 | intergenic_region ; MODIFIER | silent_mutation | Average:18.111; most accessible tissue: Callus, score: 41.206 | N | N | N | N |
vg0603483013 | A -> DEL | N | N | silent_mutation | Average:18.111; most accessible tissue: Callus, score: 41.206 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0603483013 | NA | 6.91E-06 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0603483013 | 7.22E-06 | NA | mr1085 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0603483013 | NA | 4.84E-10 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0603483013 | NA | 2.65E-06 | mr1682 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0603483013 | NA | 7.67E-06 | mr1742 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0603483013 | NA | 3.91E-06 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0603483013 | NA | 5.04E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |