\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0603483013:

Variant ID: vg0603483013 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 3483013
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATATTTCATGTGGGATTGGATTCAAATGAATTGGATTTGATTTTACTGTTTCTTTTAGCTAATCATGGCATCAAGCTATCAACATGGTCCGAATATTTA[A/G]
TATTTGAACTATAAATTAAATTAGTAATTAACCTTCCCTTTGTTTGGGTTTGCTTTCTTTGTAATTATTTACGGTTTGGCAAGCAATAGCAATCATAACA

Reverse complement sequence

TGTTATGATTGCTATTGCTTGCCAAACCGTAAATAATTACAAAGAAAGCAAACCCAAACAAAGGGAAGGTTAATTACTAATTTAATTTATAGTTCAAATA[T/C]
TAAATATTCGGACCATGTTGATAGCTTGATGCCATGATTAGCTAAAAGAAACAGTAAAATCAAATCCAATTCATTTGAATCCAATCCCACATGAAATATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.40% 2.90% 7.64% 25.03% NA
All Indica  2759 74.30% 0.30% 3.23% 22.22% NA
All Japonica  1512 38.20% 8.40% 17.39% 35.98% NA
Aus  269 98.10% 0.40% 0.37% 1.12% NA
Indica I  595 64.70% 0.00% 2.86% 32.44% NA
Indica II  465 79.60% 0.60% 2.15% 17.63% NA
Indica III  913 77.30% 0.30% 3.83% 18.51% NA
Indica Intermediate  786 74.80% 0.30% 3.44% 21.50% NA
Temperate Japonica  767 56.50% 0.50% 5.35% 37.68% NA
Tropical Japonica  504 17.70% 22.20% 31.75% 28.37% NA
Japonica Intermediate  241 23.20% 4.60% 25.73% 46.47% NA
VI/Aromatic  96 91.70% 0.00% 7.29% 1.04% NA
Intermediate  90 73.30% 1.10% 1.11% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0603483013 A -> G LOC_Os06g07270.1 downstream_gene_variant ; 612.0bp to feature; MODIFIER silent_mutation Average:18.111; most accessible tissue: Callus, score: 41.206 N N N N
vg0603483013 A -> G LOC_Os06g07260-LOC_Os06g07270 intergenic_region ; MODIFIER silent_mutation Average:18.111; most accessible tissue: Callus, score: 41.206 N N N N
vg0603483013 A -> DEL N N silent_mutation Average:18.111; most accessible tissue: Callus, score: 41.206 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0603483013 NA 6.91E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603483013 7.22E-06 NA mr1085 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603483013 NA 4.84E-10 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603483013 NA 2.65E-06 mr1682 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603483013 NA 7.67E-06 mr1742 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603483013 NA 3.91E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603483013 NA 5.04E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251