Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0603117706:

Variant ID: vg0603117706 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 3117706
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:

ATACTCAGGACCCTCTCCCAGATATGGCACACAAAAGCGCAATCTTTAAAAAGATGTTGGGCGGTTTCAAGGTTCCTATAGCATAGTTGGCAGAAATAGT[T/C]
GTTTGGCCATTGTCTGATTTGTAGCCTATCTATTGTCCAAACTCTATTTTGCAATAGAAGCCATGTAAAGTGTTTGCATTTGGAAGGTGCCCATTGCTTC

Reverse complement sequence

GAAGCAATGGGCACCTTCCAAATGCAAACACTTTACATGGCTTCTATTGCAAAATAGAGTTTGGACAATAGATAGGCTACAAATCAGACAATGGCCAAAC[A/G]
ACTATTTCTGCCAACTATGCTATAGGAACCTTGAAACCGCCCAACATCTTTTTAAAGATTGCGCTTTTGTGTGCCATATCTGGGAGAGGGTCCTGAGTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.20%	14.70%	4.49%	6.60%	NA
All Indica	2759	83.90%	9.20%	1.59%	5.26%	NA
All Japonica	1512	62.20%	28.20%	9.46%	0.13%	NA
Aus	269	33.80%	0.40%	6.69%	59.11%	NA
Indica I	595	92.40%	0.70%	1.68%	5.21%	NA
Indica II	465	57.00%	40.60%	2.37%	0.00%	NA
Indica III	913	98.70%	0.20%	0.22%	0.88%	NA
Indica Intermediate	786	76.30%	7.50%	2.67%	13.49%	NA
Temperate Japonica	767	46.30%	39.60%	14.08%	0.00%	NA
Tropical Japonica	504	87.30%	8.10%	4.17%	0.40%	NA
Japonica Intermediate	241	60.20%	34.00%	5.81%	0.00%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	72.20%	15.60%	7.78%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0603117706	T -> C	LOC_Os06g06620.1	upstream_gene_variant ; 1680.0bp to feature; MODIFIER	silent_mutation	Average:54.009; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0603117706	T -> C	LOC_Os06g06640.1	upstream_gene_variant ; 2223.0bp to feature; MODIFIER	silent_mutation	Average:54.009; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0603117706	T -> C	LOC_Os06g06610.1	downstream_gene_variant ; 2512.0bp to feature; MODIFIER	silent_mutation	Average:54.009; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0603117706	T -> C	LOC_Os06g06630.1	downstream_gene_variant ; 472.0bp to feature; MODIFIER	silent_mutation	Average:54.009; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0603117706	T -> C	LOC_Os06g06650.1	downstream_gene_variant ; 3999.0bp to feature; MODIFIER	silent_mutation	Average:54.009; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0603117706	T -> C	LOC_Os06g06620-LOC_Os06g06630	intergenic_region ; MODIFIER	silent_mutation	Average:54.009; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg0603117706	T -> DEL	N	N	silent_mutation	Average:54.009; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0603117706	NA	3.86E-07	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706	NA	1.34E-08	mr1044	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706	NA	6.10E-12	mr1079	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706	NA	1.77E-14	mr1141	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706	NA	3.40E-11	mr1390	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706	NA	2.28E-06	mr1482	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706	NA	1.43E-11	mr1490	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706	NA	4.58E-07	mr1805	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706	NA	2.24E-06	mr1060_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706	NA	9.07E-07	mr1060_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706	NA	3.32E-08	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706	NA	8.52E-13	mr1141_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706	NA	1.00E-05	mr1173_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706	NA	5.10E-07	mr1383_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706	NA	6.27E-06	mr1567_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706	NA	5.30E-06	mr1588_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706	NA	8.53E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706	NA	5.51E-09	mr1907_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706	NA	2.84E-09	mr1934_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251