\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0603117706:

Variant ID: vg0603117706 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 3117706
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


ATACTCAGGACCCTCTCCCAGATATGGCACACAAAAGCGCAATCTTTAAAAAGATGTTGGGCGGTTTCAAGGTTCCTATAGCATAGTTGGCAGAAATAGT[T/C]
GTTTGGCCATTGTCTGATTTGTAGCCTATCTATTGTCCAAACTCTATTTTGCAATAGAAGCCATGTAAAGTGTTTGCATTTGGAAGGTGCCCATTGCTTC

Reverse complement sequence

GAAGCAATGGGCACCTTCCAAATGCAAACACTTTACATGGCTTCTATTGCAAAATAGAGTTTGGACAATAGATAGGCTACAAATCAGACAATGGCCAAAC[A/G]
ACTATTTCTGCCAACTATGCTATAGGAACCTTGAAACCGCCCAACATCTTTTTAAAGATTGCGCTTTTGTGTGCCATATCTGGGAGAGGGTCCTGAGTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.20% 14.70% 4.49% 6.60% NA
All Indica  2759 83.90% 9.20% 1.59% 5.26% NA
All Japonica  1512 62.20% 28.20% 9.46% 0.13% NA
Aus  269 33.80% 0.40% 6.69% 59.11% NA
Indica I  595 92.40% 0.70% 1.68% 5.21% NA
Indica II  465 57.00% 40.60% 2.37% 0.00% NA
Indica III  913 98.70% 0.20% 0.22% 0.88% NA
Indica Intermediate  786 76.30% 7.50% 2.67% 13.49% NA
Temperate Japonica  767 46.30% 39.60% 14.08% 0.00% NA
Tropical Japonica  504 87.30% 8.10% 4.17% 0.40% NA
Japonica Intermediate  241 60.20% 34.00% 5.81% 0.00% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 72.20% 15.60% 7.78% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0603117706 T -> C LOC_Os06g06620.1 upstream_gene_variant ; 1680.0bp to feature; MODIFIER silent_mutation Average:54.009; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0603117706 T -> C LOC_Os06g06640.1 upstream_gene_variant ; 2223.0bp to feature; MODIFIER silent_mutation Average:54.009; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0603117706 T -> C LOC_Os06g06610.1 downstream_gene_variant ; 2512.0bp to feature; MODIFIER silent_mutation Average:54.009; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0603117706 T -> C LOC_Os06g06630.1 downstream_gene_variant ; 472.0bp to feature; MODIFIER silent_mutation Average:54.009; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0603117706 T -> C LOC_Os06g06650.1 downstream_gene_variant ; 3999.0bp to feature; MODIFIER silent_mutation Average:54.009; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0603117706 T -> C LOC_Os06g06620-LOC_Os06g06630 intergenic_region ; MODIFIER silent_mutation Average:54.009; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0603117706 T -> DEL N N silent_mutation Average:54.009; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0603117706 NA 3.86E-07 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706 NA 1.34E-08 mr1044 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706 NA 6.10E-12 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706 NA 1.77E-14 mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706 NA 3.40E-11 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706 NA 2.28E-06 mr1482 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706 NA 1.43E-11 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706 NA 4.58E-07 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706 NA 2.24E-06 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706 NA 9.07E-07 mr1060_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706 NA 3.32E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706 NA 8.52E-13 mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706 NA 1.00E-05 mr1173_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706 NA 5.10E-07 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706 NA 6.27E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706 NA 5.30E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706 NA 8.53E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706 NA 5.51E-09 mr1907_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603117706 NA 2.84E-09 mr1934_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251