| Variant ID: vg0603087867 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 3087867 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTCACTAAAAACAAAGTTCAATAGAAAAAACACATAAATAATTTAGTTAAAACTTTTAAAAGAATAGTTGAAAATTTCAAATATGTAGTTGAAAGTTTTC[G/A]
AAATTCGAGTTGAAGTTTCGAAATCTTAAGTGAAAGTATTCAATTTTGGTATAGCTTATTTTTTTATAACTTTTTAATTATTAAAGTAATTTTTAATTTT
AAAATTAAAAATTACTTTAATAATTAAAAAGTTATAAAAAAATAAGCTATACCAAAATTGAATACTTTCACTTAAGATTTCGAAACTTCAACTCGAATTT[C/T]
GAAAACTTTCAACTACATATTTGAAATTTTCAACTATTCTTTTAAAAGTTTTAACTAAATTATTTATGTGTTTTTTCTATTGAACTTTGTTTTTAGTGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.40% | 2.50% | 5.29% | 35.78% | NA |
| All Indica | 2759 | 39.60% | 2.00% | 6.92% | 51.47% | NA |
| All Japonica | 1512 | 95.00% | 3.80% | 0.73% | 0.53% | NA |
| Aus | 269 | 11.90% | 0.00% | 12.27% | 75.84% | NA |
| Indica I | 595 | 36.60% | 3.70% | 7.90% | 51.76% | NA |
| Indica II | 465 | 76.30% | 0.00% | 2.80% | 20.86% | NA |
| Indica III | 913 | 19.50% | 2.10% | 9.09% | 69.33% | NA |
| Indica Intermediate | 786 | 43.50% | 1.80% | 6.11% | 48.60% | NA |
| Temperate Japonica | 767 | 92.20% | 6.80% | 0.91% | 0.13% | NA |
| Tropical Japonica | 504 | 98.60% | 0.00% | 0.60% | 0.79% | NA |
| Japonica Intermediate | 241 | 96.30% | 2.10% | 0.41% | 1.24% | NA |
| VI/Aromatic | 96 | 37.50% | 5.20% | 12.50% | 44.79% | NA |
| Intermediate | 90 | 76.70% | 2.20% | 3.33% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0603087867 | G -> A | LOC_Os06g06560.1 | upstream_gene_variant ; 1059.0bp to feature; MODIFIER | silent_mutation | Average:20.555; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0603087867 | G -> A | LOC_Os06g06570.1 | downstream_gene_variant ; 2280.0bp to feature; MODIFIER | silent_mutation | Average:20.555; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0603087867 | G -> A | LOC_Os06g06560-LOC_Os06g06570 | intergenic_region ; MODIFIER | silent_mutation | Average:20.555; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0603087867 | G -> DEL | N | N | silent_mutation | Average:20.555; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0603087867 | 3.26E-06 | 3.26E-06 | mr1038 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603087867 | NA | 1.24E-06 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603087867 | 1.02E-07 | 1.02E-07 | mr1389 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603087867 | NA | 4.20E-07 | mr1038_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603087867 | 2.29E-07 | 2.29E-07 | mr1389_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603087867 | NA | 5.43E-06 | mr1932_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |