Search for Variation information by Variation ID:
Detailed information for vg0603075208:
| Variant ID: vg0603075208 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 3075208 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, C: 0.12, others allele: 0.00, population size: 82. )
Flanking Sequence (100 bp) in Reference Genome:
GAGCTTGTATTCCCGGAGCGCCTTCGCGACGTCGTCCTTGAGCCCCGGGATGTCGCCGGCGGCGGCGTGGACCGCCGCCTCGGCGAGGTCGGCCACGGCG[A/C]
GCAGGTGCTTGATCGGGAGCTGGTTCTCGAGCTTGATCACGTCCGTGACGATGTCCTGCATGTGCGTCGCCTTGAAGCTCTCGTCGACGGCGTCACGCCT
Reverse complement sequence
AGGCGTGACGCCGTCGACGAGAGCTTCAAGGCGACGCACATGCAGGACATCGTCACGGACGTGATCAAGCTCGAGAACCAGCTCCCGATCAAGCACCTGC[T/G]
CGCCGTGGCCGACCTCGCCGAGGCGGCGGTCCACGCCGCCGCCGGCGACATCCCGGGGCTCAAGGACGACGTCGCGAAGGCGCTCCGGGAATACAAGCTC
Allele Frequencies:
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.10% | 9.80% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 85.20% | 14.70% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 96.40% | 3.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 75.00% | 24.90% | 0.17% | 0.00% | NA |
| Indica II | 465 | 76.80% | 23.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 81.20% | 18.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.90% | 19.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0603075208 | A -> C | LOC_Os06g06550.1 | missense_variant ; p.Leu196Arg; MODERATE | nonsynonymous_codon ; L196R | Average:67.623; most accessible tissue: Minghui63 panicle, score: 83.421 | benign  |
0.233 |
DELETERIOUS | 0.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0603075208 | NA | 9.56E-06 | mr1005 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603075208 | NA | 4.78E-10 | mr1011 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603075208 | NA | 8.75E-08 | mr1011 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603075208 | 2.31E-06 | 2.30E-06 | mr1012 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603075208 | NA | 8.62E-06 | mr1012 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603075208 | NA | 2.86E-06 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0603075208 | NA | 4.17E-06 | mr1706 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |