\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0603075208:

Variant ID: vg0603075208 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 3075208
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, C: 0.12, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


GAGCTTGTATTCCCGGAGCGCCTTCGCGACGTCGTCCTTGAGCCCCGGGATGTCGCCGGCGGCGGCGTGGACCGCCGCCTCGGCGAGGTCGGCCACGGCG[A/C]
GCAGGTGCTTGATCGGGAGCTGGTTCTCGAGCTTGATCACGTCCGTGACGATGTCCTGCATGTGCGTCGCCTTGAAGCTCTCGTCGACGGCGTCACGCCT

Reverse complement sequence

AGGCGTGACGCCGTCGACGAGAGCTTCAAGGCGACGCACATGCAGGACATCGTCACGGACGTGATCAAGCTCGAGAACCAGCTCCCGATCAAGCACCTGC[T/G]
CGCCGTGGCCGACCTCGCCGAGGCGGCGGTCCACGCCGCCGCCGGCGACATCCCGGGGCTCAAGGACGACGTCGCGAAGGCGCTCCGGGAATACAAGCTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.10% 9.80% 0.04% 0.00% NA
All Indica  2759 85.20% 14.70% 0.07% 0.00% NA
All Japonica  1512 96.40% 3.60% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 75.00% 24.90% 0.17% 0.00% NA
Indica II  465 76.80% 23.20% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 81.20% 18.70% 0.13% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 80.90% 19.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0603075208 A -> C LOC_Os06g06550.1 missense_variant ; p.Leu196Arg; MODERATE nonsynonymous_codon ; L196R Average:67.623; most accessible tissue: Minghui63 panicle, score: 83.421 benign 0.233 DELETERIOUS 0.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0603075208 NA 9.56E-06 mr1005 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603075208 NA 4.78E-10 mr1011 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603075208 NA 8.75E-08 mr1011 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603075208 2.31E-06 2.30E-06 mr1012 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603075208 NA 8.62E-06 mr1012 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603075208 NA 2.86E-06 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0603075208 NA 4.17E-06 mr1706 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251