\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0602860835:

Variant ID: vg0602860835 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 2860835
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


GTCAGGAGAAGATACAGTCAGACCAAACACCTGGATGGCTCGACGGCAAGGCTCCTCATTATTCTTCTTCTTCATTCTCAGTGGTAACTGAGGCACTGCA[G/A]
CAGAAATAACCAGTAAATATGGTAAAGTTCAAGAACATATAAAGTTAAATATTTTTTTCTTTTCTTGAAAAAGATTGGTATGTGAAACGATGAACTTACT

Reverse complement sequence

AGTAAGTTCATCGTTTCACATACCAATCTTTTTCAAGAAAAGAAAAAAATATTTAACTTTATATGTTCTTGAACTTTACCATATTTACTGGTTATTTCTG[C/T]
TGCAGTGCCTCAGTTACCACTGAGAATGAAGAAGAAGAATAATGAGGAGCCTTGCCGTCGAGCCATCCAGGTGTTTGGTCTGACTGTATCTTCTCCTGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.10% 6.80% 0.36% 2.81% NA
All Indica  2759 90.60% 7.40% 0.11% 1.81% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 25.70% 40.10% 4.83% 29.37% NA
Indica I  595 87.10% 12.90% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 95.60% 1.30% 0.22% 2.85% NA
Indica Intermediate  786 82.20% 14.60% 0.13% 3.05% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 2.10% 0.00% 1.04% NA
Intermediate  90 92.20% 3.30% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0602860835 G -> A LOC_Os06g06170.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:59.831; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N
vg0602860835 G -> A LOC_Os06g06190.1 upstream_gene_variant ; 2576.0bp to feature; MODIFIER silent_mutation Average:59.831; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N
vg0602860835 G -> A LOC_Os06g06160.1 downstream_gene_variant ; 1274.0bp to feature; MODIFIER silent_mutation Average:59.831; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N
vg0602860835 G -> A LOC_Os06g06180.1 downstream_gene_variant ; 865.0bp to feature; MODIFIER silent_mutation Average:59.831; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N
vg0602860835 G -> A LOC_Os06g06160.4 downstream_gene_variant ; 1274.0bp to feature; MODIFIER silent_mutation Average:59.831; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N
vg0602860835 G -> A LOC_Os06g06160.3 downstream_gene_variant ; 1274.0bp to feature; MODIFIER silent_mutation Average:59.831; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N
vg0602860835 G -> A LOC_Os06g06160.5 downstream_gene_variant ; 1274.0bp to feature; MODIFIER silent_mutation Average:59.831; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N
vg0602860835 G -> A LOC_Os06g06160.2 downstream_gene_variant ; 1274.0bp to feature; MODIFIER silent_mutation Average:59.831; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N
vg0602860835 G -> DEL N N silent_mutation Average:59.831; most accessible tissue: Minghui63 flag leaf, score: 74.161 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0602860835 NA 4.12E-06 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602860835 2.61E-06 5.00E-08 mr1477_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602860835 NA 9.01E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602860835 NA 1.74E-08 mr1971_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251