Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0602860835:

Variant ID: vg0602860835 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 2860835
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

GTCAGGAGAAGATACAGTCAGACCAAACACCTGGATGGCTCGACGGCAAGGCTCCTCATTATTCTTCTTCTTCATTCTCAGTGGTAACTGAGGCACTGCA[G/A]
CAGAAATAACCAGTAAATATGGTAAAGTTCAAGAACATATAAAGTTAAATATTTTTTTCTTTTCTTGAAAAAGATTGGTATGTGAAACGATGAACTTACT

Reverse complement sequence

AGTAAGTTCATCGTTTCACATACCAATCTTTTTCAAGAAAAGAAAAAAATATTTAACTTTATATGTTCTTGAACTTTACCATATTTACTGGTTATTTCTG[C/T]
TGCAGTGCCTCAGTTACCACTGAGAATGAAGAAGAAGAATAATGAGGAGCCTTGCCGTCGAGCCATCCAGGTGTTTGGTCTGACTGTATCTTCTCCTGAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.10%	6.80%	0.36%	2.81%	NA
All Indica	2759	90.60%	7.40%	0.11%	1.81%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	25.70%	40.10%	4.83%	29.37%	NA
Indica I	595	87.10%	12.90%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	95.60%	1.30%	0.22%	2.85%	NA
Indica Intermediate	786	82.20%	14.60%	0.13%	3.05%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	2.10%	0.00%	1.04%	NA
Intermediate	90	92.20%	3.30%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0602860835	G -> A	LOC_Os06g06170.1	splice_region_variant&intron_variant ; LOW	silent_mutation	Average:59.831; most accessible tissue: Minghui63 flag leaf, score: 74.161	N	N	N	N
vg0602860835	G -> A	LOC_Os06g06190.1	upstream_gene_variant ; 2576.0bp to feature; MODIFIER	silent_mutation	Average:59.831; most accessible tissue: Minghui63 flag leaf, score: 74.161	N	N	N	N
vg0602860835	G -> A	LOC_Os06g06160.1	downstream_gene_variant ; 1274.0bp to feature; MODIFIER	silent_mutation	Average:59.831; most accessible tissue: Minghui63 flag leaf, score: 74.161	N	N	N	N
vg0602860835	G -> A	LOC_Os06g06180.1	downstream_gene_variant ; 865.0bp to feature; MODIFIER	silent_mutation	Average:59.831; most accessible tissue: Minghui63 flag leaf, score: 74.161	N	N	N	N
vg0602860835	G -> A	LOC_Os06g06160.4	downstream_gene_variant ; 1274.0bp to feature; MODIFIER	silent_mutation	Average:59.831; most accessible tissue: Minghui63 flag leaf, score: 74.161	N	N	N	N
vg0602860835	G -> A	LOC_Os06g06160.3	downstream_gene_variant ; 1274.0bp to feature; MODIFIER	silent_mutation	Average:59.831; most accessible tissue: Minghui63 flag leaf, score: 74.161	N	N	N	N
vg0602860835	G -> A	LOC_Os06g06160.5	downstream_gene_variant ; 1274.0bp to feature; MODIFIER	silent_mutation	Average:59.831; most accessible tissue: Minghui63 flag leaf, score: 74.161	N	N	N	N
vg0602860835	G -> A	LOC_Os06g06160.2	downstream_gene_variant ; 1274.0bp to feature; MODIFIER	silent_mutation	Average:59.831; most accessible tissue: Minghui63 flag leaf, score: 74.161	N	N	N	N
vg0602860835	G -> DEL	N	N	silent_mutation	Average:59.831; most accessible tissue: Minghui63 flag leaf, score: 74.161	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0602860835	NA	4.12E-06	mr1013	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602860835	2.61E-06	5.00E-08	mr1477_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602860835	NA	9.01E-06	mr1756_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602860835	NA	1.74E-08	mr1971_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251