\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0602811391:

Variant ID: vg0602811391 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 2811391
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.87, A: 0.13, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


GTTATAATAAAGAGGGTGCAAAAGGGTGCCACCACGTTCAATCTAGAAGCCTAGAATAACGACATTAATCGGGGAAAAAAGATAAATATATGCCCGTTTA[T/A]
TATAGTGGTGGGTCTAGATTACAACGGTCCAGGTTGACCAGTAAATTCTATACAAAATATAACTCTAATTTTAAATCTAGCTCCTCTCATATTTGCATGG

Reverse complement sequence

CCATGCAAATATGAGAGGAGCTAGATTTAAAATTAGAGTTATATTTTGTATAGAATTTACTGGTCAACCTGGACCGTTGTAATCTAGACCCACCACTATA[A/T]
TAAACGGGCATATATTTATCTTTTTTCCCCGATTAATGTCGTTATTCTAGGCTTCTAGATTGAACGTGGTGGCACCCTTTTGCACCCTCTTTATTATAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.80% 40.00% 0.19% 0.00% NA
All Indica  2759 87.90% 11.90% 0.18% 0.00% NA
All Japonica  1512 2.20% 97.60% 0.20% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 53.30% 46.70% 0.00% 0.00% NA
Indica III  913 98.90% 1.00% 0.11% 0.00% NA
Indica Intermediate  786 87.50% 12.00% 0.51% 0.00% NA
Temperate Japonica  767 2.70% 97.00% 0.26% 0.00% NA
Tropical Japonica  504 2.20% 97.60% 0.20% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 65.60% 34.40% 0.00% 0.00% NA
Intermediate  90 41.10% 57.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0602811391 T -> A LOC_Os06g06100.1 downstream_gene_variant ; 4556.0bp to feature; MODIFIER silent_mutation Average:66.548; most accessible tissue: Minghui63 flower, score: 82.765 N N N N
vg0602811391 T -> A LOC_Os06g06090.1 intron_variant ; MODIFIER silent_mutation Average:66.548; most accessible tissue: Minghui63 flower, score: 82.765 N N N N
vg0602811391 T -> A LOC_Os06g06090.2 intron_variant ; MODIFIER silent_mutation Average:66.548; most accessible tissue: Minghui63 flower, score: 82.765 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0602811391 NA 1.40E-12 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602811391 2.56E-17 8.83E-89 mr1141 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602811391 1.25E-23 3.75E-45 mr1141 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602811391 NA 4.80E-13 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602811391 NA 6.70E-23 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602811391 NA 6.06E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602811391 NA 3.74E-06 mr1192 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602811391 NA 1.16E-07 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602811391 NA 6.64E-14 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602811391 NA 1.20E-22 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602811391 NA 5.02E-07 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602811391 NA 4.07E-07 mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602811391 NA 1.13E-25 mr1903 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602811391 NA 7.27E-14 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602811391 3.87E-09 1.46E-92 mr1141_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602811391 3.41E-11 3.46E-37 mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602811391 NA 2.36E-27 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602811391 NA 5.48E-28 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602811391 NA 4.09E-22 mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602811391 NA 5.49E-07 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251