\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0602416881:

Variant ID: vg0602416881 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 2416881
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.76, C: 0.24, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTAGCCTATCACATCAACAGAGATCATGCCTGCAGATGCAGACCCCGCTGTCTCTAGCTGATTAACCTCTCCTTCGTGATGATTAACACTACAATCAC[A/C]
GCAATGGTGATCAAATCTAGCGAGTGGCCAGCTCGAGTTCTGTATTGCTTGTTGTCTCCCCCTGCCTGGTGTACCCAAGGCTTAGGTCACTGTCTCTTCT

Reverse complement sequence

AGAAGAGACAGTGACCTAAGCCTTGGGTACACCAGGCAGGGGGAGACAACAAGCAATACAGAACTCGAGCTGGCCACTCGCTAGATTTGATCACCATTGC[T/G]
GTGATTGTAGTGTTAATCATCACGAAGGAGAGGTTAATCAGCTAGAGACAGCGGGGTCTGCATCTGCAGGCATGATCTCTGTTGATGTGATAGGCTACAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.10% 40.60% 0.06% 0.21% NA
All Indica  2759 87.40% 12.30% 0.11% 0.25% NA
All Japonica  1512 1.00% 98.90% 0.00% 0.13% NA
Aus  269 95.50% 4.50% 0.00% 0.00% NA
Indica I  595 98.80% 0.80% 0.17% 0.17% NA
Indica II  465 52.90% 46.70% 0.00% 0.43% NA
Indica III  913 97.80% 1.90% 0.22% 0.11% NA
Indica Intermediate  786 87.00% 12.60% 0.00% 0.38% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.40% 0.00% 0.40% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 79.20% 20.80% 0.00% 0.00% NA
Intermediate  90 37.80% 61.10% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0602416881 A -> C LOC_Os06g05359.1 3_prime_UTR_variant ; 38.0bp to feature; MODIFIER silent_mutation Average:69.501; most accessible tissue: Minghui63 flag leaf, score: 81.566 N N N N
vg0602416881 A -> C LOC_Os06g05368.1 upstream_gene_variant ; 1820.0bp to feature; MODIFIER silent_mutation Average:69.501; most accessible tissue: Minghui63 flag leaf, score: 81.566 N N N N
vg0602416881 A -> C LOC_Os06g05368.2 upstream_gene_variant ; 1820.0bp to feature; MODIFIER silent_mutation Average:69.501; most accessible tissue: Minghui63 flag leaf, score: 81.566 N N N N
vg0602416881 A -> DEL N N silent_mutation Average:69.501; most accessible tissue: Minghui63 flag leaf, score: 81.566 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0602416881 NA 3.14E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602416881 NA 3.13E-12 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602416881 4.65E-26 2.72E-106 mr1141 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602416881 5.79E-19 1.27E-43 mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602416881 NA 4.64E-13 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602416881 NA 5.45E-23 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602416881 NA 1.10E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602416881 NA 6.67E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602416881 NA 2.42E-14 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602416881 NA 4.82E-14 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602416881 9.51E-24 6.88E-117 mr1141_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602416881 5.30E-15 5.35E-42 mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602416881 NA 9.19E-27 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602416881 NA 1.12E-08 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602416881 NA 1.28E-27 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602416881 NA 3.44E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602416881 NA 1.50E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602416881 NA 4.80E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251