Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0602403184:

Variant ID: vg0602403184 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 2403184
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:

GCCTCCAGCTAGCAGGGGCGGATCTAGGAGGGGCTAAATAAACTATACAAAACTACAGCCTCTCTTCTAATGGATGTATGACAAAAAATTTTAATGGTGA[C/T]
TTCATGGGGCTCCCATGGTTACAACGTTGGTAGTGGGGCCTCAAAGACCCCGGAGCCCCATGGTGGATCCGCCACTGCCAGCTAGCTAATAAAATGTTGA

Reverse complement sequence

TCAACATTTTATTAGCTAGCTGGCAGTGGCGGATCCACCATGGGGCTCCGGGGTCTTTGAGGCCCCACTACCAACGTTGTAACCATGGGAGCCCCATGAA[G/A]
TCACCATTAAAATTTTTTGTCATACATCCATTAGAAGAGAGGCTGTAGTTTTGTATAGTTTATTTAGCCCCTCCTAGATCCGCCCCTGCTAGCTGGAGGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.30%	40.60%	0.04%	0.00%	NA
All Indica	2759	87.70%	12.30%	0.04%	0.00%	NA
All Japonica	1512	1.10%	98.90%	0.07%	0.00%	NA
Aus	269	95.50%	4.50%	0.00%	0.00%	NA
Indica I	595	99.00%	1.00%	0.00%	0.00%	NA
Indica II	465	53.30%	46.50%	0.22%	0.00%	NA
Indica III	913	98.10%	1.90%	0.00%	0.00%	NA
Indica Intermediate	786	87.40%	12.60%	0.00%	0.00%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	1.40%	98.40%	0.20%	0.00%	NA
Japonica Intermediate	241	2.50%	97.50%	0.00%	0.00%	NA
VI/Aromatic	96	79.20%	20.80%	0.00%	0.00%	NA
Intermediate	90	38.90%	61.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0602403184	C -> T	LOC_Os06g05330.1	upstream_gene_variant ; 4372.0bp to feature; MODIFIER	silent_mutation	Average:59.969; most accessible tissue: Callus, score: 87.53	N	N	N	N
vg0602403184	C -> T	LOC_Os06g05340.1	upstream_gene_variant ; 594.0bp to feature; MODIFIER	silent_mutation	Average:59.969; most accessible tissue: Callus, score: 87.53	N	N	N	N
vg0602403184	C -> T	LOC_Os06g05350.1	upstream_gene_variant ; 2225.0bp to feature; MODIFIER	silent_mutation	Average:59.969; most accessible tissue: Callus, score: 87.53	N	N	N	N
vg0602403184	C -> T	LOC_Os06g05340-LOC_Os06g05350	intergenic_region ; MODIFIER	silent_mutation	Average:59.969; most accessible tissue: Callus, score: 87.53	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0602403184	NA	2.34E-06	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602403184	NA	5.27E-13	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602403184	2.09E-28	6.58E-109	mr1141	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602403184	9.60E-22	2.30E-46	mr1141	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602403184	NA	5.42E-14	mr1149	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602403184	NA	3.79E-23	mr1150	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602403184	NA	3.45E-06	mr1192	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602403184	NA	8.10E-15	mr1441	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602403184	NA	5.69E-06	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602403184	NA	6.59E-14	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602403184	7.00E-24	1.74E-117	mr1141_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602403184	3.29E-16	1.96E-43	mr1141_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602403184	NA	1.43E-26	mr1149_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602403184	NA	6.34E-31	mr1150_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602403184	NA	4.43E-09	mr1222_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602403184	NA	4.19E-27	mr1441_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251