\
| Variant ID: vg0602403184 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 2403184 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 119. )
GCCTCCAGCTAGCAGGGGCGGATCTAGGAGGGGCTAAATAAACTATACAAAACTACAGCCTCTCTTCTAATGGATGTATGACAAAAAATTTTAATGGTGA[C/T]
TTCATGGGGCTCCCATGGTTACAACGTTGGTAGTGGGGCCTCAAAGACCCCGGAGCCCCATGGTGGATCCGCCACTGCCAGCTAGCTAATAAAATGTTGA
TCAACATTTTATTAGCTAGCTGGCAGTGGCGGATCCACCATGGGGCTCCGGGGTCTTTGAGGCCCCACTACCAACGTTGTAACCATGGGAGCCCCATGAA[G/A]
TCACCATTAAAATTTTTTGTCATACATCCATTAGAAGAGAGGCTGTAGTTTTGTATAGTTTATTTAGCCCCTCCTAGATCCGCCCCTGCTAGCTGGAGGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.30% | 40.60% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 87.70% | 12.30% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 1.10% | 98.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 53.30% | 46.50% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 87.40% | 12.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.40% | 98.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 79.20% | 20.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 38.90% | 61.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0602403184 | C -> T | LOC_Os06g05330.1 | upstream_gene_variant ; 4372.0bp to feature; MODIFIER | silent_mutation | Average:59.969; most accessible tissue: Callus, score: 87.53 | N | N | N | N |
| vg0602403184 | C -> T | LOC_Os06g05340.1 | upstream_gene_variant ; 594.0bp to feature; MODIFIER | silent_mutation | Average:59.969; most accessible tissue: Callus, score: 87.53 | N | N | N | N |
| vg0602403184 | C -> T | LOC_Os06g05350.1 | upstream_gene_variant ; 2225.0bp to feature; MODIFIER | silent_mutation | Average:59.969; most accessible tissue: Callus, score: 87.53 | N | N | N | N |
| vg0602403184 | C -> T | LOC_Os06g05340-LOC_Os06g05350 | intergenic_region ; MODIFIER | silent_mutation | Average:59.969; most accessible tissue: Callus, score: 87.53 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0602403184 | NA | 2.34E-06 | mr1044 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602403184 | NA | 5.27E-13 | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602403184 | 2.09E-28 | 6.58E-109 | mr1141 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602403184 | 9.60E-22 | 2.30E-46 | mr1141 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602403184 | NA | 5.42E-14 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602403184 | NA | 3.79E-23 | mr1150 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602403184 | NA | 3.45E-06 | mr1192 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602403184 | NA | 8.10E-15 | mr1441 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602403184 | NA | 5.69E-06 | mr1598 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602403184 | NA | 6.59E-14 | mr1982 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602403184 | 7.00E-24 | 1.74E-117 | mr1141_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602403184 | 3.29E-16 | 1.96E-43 | mr1141_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602403184 | NA | 1.43E-26 | mr1149_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602403184 | NA | 6.34E-31 | mr1150_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602403184 | NA | 4.43E-09 | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602403184 | NA | 4.19E-27 | mr1441_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |