\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0602397891:

Variant ID: vg0602397891 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 2397891
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, A: 0.10, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TATTACCATGCACATTATTTTGCCATTTAATTTCACACATTTTTATCACTCGGCACTCCCCGTCCCACTTAAATTGCACCCTTGTTTTCAGCTGCGATTG[T/A]
AGGGGATGGTCCAGGTGATCTCCGGACTGCTCTATCTTTGTTGATAAGAGTTGTAAACCAACACATCTATTAGCGGATCATCGGATCCGTTTTCTATCCC

Reverse complement sequence

GGGATAGAAAACGGATCCGATGATCCGCTAATAGATGTGTTGGTTTACAACTCTTATCAACAAAGATAGAGCAGTCCGGAGATCACCTGGACCATCCCCT[A/T]
CAATCGCAGCTGAAAACAAGGGTGCAATTTAAGTGGGACGGGGAGTGCCGAGTGATAAAAATGTGTGAAATTAAATGGCAAAATAATGTGCATGGTAATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.20% 40.60% 0.21% 0.00% NA
All Indica  2759 87.50% 12.20% 0.25% 0.00% NA
All Japonica  1512 1.00% 98.90% 0.07% 0.00% NA
Aus  269 95.50% 4.50% 0.00% 0.00% NA
Indica I  595 98.80% 0.80% 0.34% 0.00% NA
Indica II  465 53.30% 46.50% 0.22% 0.00% NA
Indica III  913 97.90% 2.00% 0.11% 0.00% NA
Indica Intermediate  786 87.20% 12.50% 0.38% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.60% 0.20% 0.00% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 79.20% 20.80% 0.00% 0.00% NA
Intermediate  90 37.80% 60.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0602397891 T -> A LOC_Os06g05320.1 downstream_gene_variant ; 1329.0bp to feature; MODIFIER silent_mutation Average:44.82; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0602397891 T -> A LOC_Os06g05330.1 downstream_gene_variant ; 465.0bp to feature; MODIFIER silent_mutation Average:44.82; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0602397891 T -> A LOC_Os06g05340.1 downstream_gene_variant ; 1800.0bp to feature; MODIFIER silent_mutation Average:44.82; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0602397891 T -> A LOC_Os06g05320-LOC_Os06g05330 intergenic_region ; MODIFIER silent_mutation Average:44.82; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0602397891 NA 2.84E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602397891 NA 4.87E-13 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602397891 1.42E-28 7.00E-109 mr1141 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602397891 9.91E-22 2.53E-46 mr1141 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602397891 NA 7.12E-14 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602397891 NA 3.01E-23 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602397891 NA 4.61E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602397891 NA 9.22E-15 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602397891 NA 5.84E-06 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602397891 NA 9.44E-14 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602397891 6.81E-24 1.99E-117 mr1141_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602397891 3.84E-16 2.37E-43 mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602397891 NA 1.51E-26 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602397891 NA 3.07E-31 mr1150_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602397891 NA 3.15E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602397891 NA 4.87E-27 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251