| Variant ID: vg0602339249 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 2339249 |
| Reference Allele: T | Alternative Allele: C,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, C: 0.18, A: 0.05, others allele: 0.00, population size: 92. )
TTTTTATTTTGAATTTCGAATTTAAGTTATTTATAAATTGTATTTCTATATGGACTCTAGTCTCCTCTTCCAATATTCTTTATATTTTTAATTCTGAATT[T/C,A]
CAACTATTTCTAAATTGTATTTCAATATGGATTCTGTTTTTTTCTCCGATTAATATGAGAATTTCTAGGTCGTGAGAGCGAACACAGAGGCTCCTTTTTC
GAAAAAGGAGCCTCTGTGTTCGCTCTCACGACCTAGAAATTCTCATATTAATCGGAGAAAAAAACAGAATCCATATTGAAATACAATTTAGAAATAGTTG[A/G,T]
AATTCAGAATTAAAAATATAAAGAATATTGGAAGAGGAGACTAGAGTCCATATAGAAATACAATTTATAAATAACTTAAATTCGAAATTCAAAATAAAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.70% | 41.80% | 0.42% | 0.00% | A: 0.04% |
| All Indica | 2759 | 85.40% | 14.20% | 0.47% | 0.00% | NA |
| All Japonica | 1512 | 0.80% | 98.90% | 0.20% | 0.00% | A: 0.13% |
| Aus | 269 | 95.20% | 4.10% | 0.74% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 52.70% | 46.90% | 0.43% | 0.00% | NA |
| Indica III | 913 | 93.50% | 6.00% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 85.10% | 14.20% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 0.40% | 99.10% | 0.26% | 0.00% | A: 0.26% |
| Tropical Japonica | 504 | 0.80% | 99.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 75.00% | 25.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 36.70% | 61.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0602339249 | T -> C | LOC_Os06g05200.1 | upstream_gene_variant ; 2952.0bp to feature; MODIFIER | silent_mutation | Average:25.855; most accessible tissue: Callus, score: 45.182 | N | N | N | N |
| vg0602339249 | T -> C | LOC_Os06g05209.1 | upstream_gene_variant ; 1060.0bp to feature; MODIFIER | silent_mutation | Average:25.855; most accessible tissue: Callus, score: 45.182 | N | N | N | N |
| vg0602339249 | T -> C | LOC_Os06g05220.1 | upstream_gene_variant ; 1675.0bp to feature; MODIFIER | silent_mutation | Average:25.855; most accessible tissue: Callus, score: 45.182 | N | N | N | N |
| vg0602339249 | T -> C | LOC_Os06g05230.1 | upstream_gene_variant ; 4288.0bp to feature; MODIFIER | silent_mutation | Average:25.855; most accessible tissue: Callus, score: 45.182 | N | N | N | N |
| vg0602339249 | T -> C | LOC_Os06g05190.1 | downstream_gene_variant ; 4775.0bp to feature; MODIFIER | silent_mutation | Average:25.855; most accessible tissue: Callus, score: 45.182 | N | N | N | N |
| vg0602339249 | T -> C | LOC_Os06g05209-LOC_Os06g05220 | intergenic_region ; MODIFIER | silent_mutation | Average:25.855; most accessible tissue: Callus, score: 45.182 | N | N | N | N |
| vg0602339249 | T -> A | LOC_Os06g05200.1 | upstream_gene_variant ; 2952.0bp to feature; MODIFIER | silent_mutation | Average:25.855; most accessible tissue: Callus, score: 45.182 | N | N | N | N |
| vg0602339249 | T -> A | LOC_Os06g05209.1 | upstream_gene_variant ; 1060.0bp to feature; MODIFIER | silent_mutation | Average:25.855; most accessible tissue: Callus, score: 45.182 | N | N | N | N |
| vg0602339249 | T -> A | LOC_Os06g05220.1 | upstream_gene_variant ; 1675.0bp to feature; MODIFIER | silent_mutation | Average:25.855; most accessible tissue: Callus, score: 45.182 | N | N | N | N |
| vg0602339249 | T -> A | LOC_Os06g05230.1 | upstream_gene_variant ; 4288.0bp to feature; MODIFIER | silent_mutation | Average:25.855; most accessible tissue: Callus, score: 45.182 | N | N | N | N |
| vg0602339249 | T -> A | LOC_Os06g05190.1 | downstream_gene_variant ; 4775.0bp to feature; MODIFIER | silent_mutation | Average:25.855; most accessible tissue: Callus, score: 45.182 | N | N | N | N |
| vg0602339249 | T -> A | LOC_Os06g05209-LOC_Os06g05220 | intergenic_region ; MODIFIER | silent_mutation | Average:25.855; most accessible tissue: Callus, score: 45.182 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0602339249 | NA | 8.73E-07 | mr1044 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602339249 | NA | 9.02E-13 | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602339249 | 1.49E-28 | 9.70E-107 | mr1141 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602339249 | 1.71E-18 | 1.80E-41 | mr1141 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602339249 | NA | 1.75E-13 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602339249 | NA | 5.30E-22 | mr1150 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602339249 | NA | 9.57E-08 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602339249 | NA | 5.36E-14 | mr1441 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602339249 | NA | 3.24E-06 | mr1598 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602339249 | NA | 9.55E-15 | mr1982 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602339249 | 5.71E-22 | 4.08E-111 | mr1141_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602339249 | 1.78E-14 | 1.19E-38 | mr1141_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602339249 | NA | 2.45E-26 | mr1149_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602339249 | NA | 1.97E-09 | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602339249 | NA | 9.71E-27 | mr1441_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602339249 | NA | 6.59E-11 | mr1756_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |