\
| Variant ID: vg0602338469 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 2338469 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 90. )
GGATAAAAACGTTTTTTTTTATAATATAACCGCTAATAGGAACTGAGCAGCGAATTCACTATGCATTATACTAGTATGGTGTCCCGTGCAGATTGCGCGC[T/A]
AGCATCATTATATTTTTTTCTCATATAATAGCATATATGTTTTCTCAATGTATTTTTCAAATATATTAAAATGACAACATAATTTTCAATTTTGTACTAA
TTAGTACAAAATTGAAAATTATGTTGTCATTTTAATATATTTGAAAAATACATTGAGAAAACATATATGCTATTATATGAGAAAAAAATATAATGATGCT[A/T]
GCGCGCAATCTGCACGGGACACCATACTAGTATAATGCATAGTGAATTCGCTGCTCAGTTCCTATTAGCGGTTATATTATAAAAAAAAACGTTTTTATCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.00% | 1.40% | 0.59% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 93.90% | 4.20% | 1.85% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 88.50% | 8.30% | 3.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0602338469 | T -> A | LOC_Os06g05200.1 | upstream_gene_variant ; 2172.0bp to feature; MODIFIER | silent_mutation | Average:59.054; most accessible tissue: Zhenshan97 panicle, score: 83.904 | N | N | N | N |
| vg0602338469 | T -> A | LOC_Os06g05209.1 | upstream_gene_variant ; 280.0bp to feature; MODIFIER | silent_mutation | Average:59.054; most accessible tissue: Zhenshan97 panicle, score: 83.904 | N | N | N | N |
| vg0602338469 | T -> A | LOC_Os06g05220.1 | upstream_gene_variant ; 2455.0bp to feature; MODIFIER | silent_mutation | Average:59.054; most accessible tissue: Zhenshan97 panicle, score: 83.904 | N | N | N | N |
| vg0602338469 | T -> A | LOC_Os06g05190.1 | downstream_gene_variant ; 3995.0bp to feature; MODIFIER | silent_mutation | Average:59.054; most accessible tissue: Zhenshan97 panicle, score: 83.904 | N | N | N | N |
| vg0602338469 | T -> A | LOC_Os06g05209-LOC_Os06g05220 | intergenic_region ; MODIFIER | silent_mutation | Average:59.054; most accessible tissue: Zhenshan97 panicle, score: 83.904 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0602338469 | NA | 4.44E-09 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0602338469 | NA | 6.24E-06 | mr1324 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602338469 | 7.70E-06 | 7.70E-06 | mr1346 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602338469 | 2.70E-06 | 2.69E-06 | mr1456 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602338469 | NA | 5.15E-06 | mr1167_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602338469 | NA | 1.62E-06 | mr1346_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602338469 | 6.39E-06 | 5.11E-08 | mr1456_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0602338469 | NA | 2.97E-06 | mr1780_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |