\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0602338469:

Variant ID: vg0602338469 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 2338469
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


GGATAAAAACGTTTTTTTTTATAATATAACCGCTAATAGGAACTGAGCAGCGAATTCACTATGCATTATACTAGTATGGTGTCCCGTGCAGATTGCGCGC[T/A]
AGCATCATTATATTTTTTTCTCATATAATAGCATATATGTTTTCTCAATGTATTTTTCAAATATATTAAAATGACAACATAATTTTCAATTTTGTACTAA

Reverse complement sequence

TTAGTACAAAATTGAAAATTATGTTGTCATTTTAATATATTTGAAAAATACATTGAGAAAACATATATGCTATTATATGAGAAAAAAATATAATGATGCT[A/T]
GCGCGCAATCTGCACGGGACACCATACTAGTATAATGCATAGTGAATTCGCTGCTCAGTTCCTATTAGCGGTTATATTATAAAAAAAAACGTTTTTATCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.00% 1.40% 0.59% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 93.90% 4.20% 1.85% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 88.50% 8.30% 3.13% 0.00% NA
Tropical Japonica  504 99.60% 0.00% 0.40% 0.00% NA
Japonica Intermediate  241 99.20% 0.00% 0.83% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0602338469 T -> A LOC_Os06g05200.1 upstream_gene_variant ; 2172.0bp to feature; MODIFIER silent_mutation Average:59.054; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg0602338469 T -> A LOC_Os06g05209.1 upstream_gene_variant ; 280.0bp to feature; MODIFIER silent_mutation Average:59.054; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg0602338469 T -> A LOC_Os06g05220.1 upstream_gene_variant ; 2455.0bp to feature; MODIFIER silent_mutation Average:59.054; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg0602338469 T -> A LOC_Os06g05190.1 downstream_gene_variant ; 3995.0bp to feature; MODIFIER silent_mutation Average:59.054; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg0602338469 T -> A LOC_Os06g05209-LOC_Os06g05220 intergenic_region ; MODIFIER silent_mutation Average:59.054; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0602338469 NA 4.44E-09 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0602338469 NA 6.24E-06 mr1324 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602338469 7.70E-06 7.70E-06 mr1346 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602338469 2.70E-06 2.69E-06 mr1456 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602338469 NA 5.15E-06 mr1167_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602338469 NA 1.62E-06 mr1346_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602338469 6.39E-06 5.11E-08 mr1456_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0602338469 NA 2.97E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251