\
| Variant ID: vg0601660746 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 1660746 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 218. )
AGTAGAGAACTAGTTATTACCAATAAGTTAATAAGTTATTTGAGGATCAAGATCTGCAACTTTAGCAGTTGCAGTGCAGCCGATGGATAAAAAATCAACG[G/A]
CTCAGGTGGCAGGAAAATGCTGTTCAGAAAATACTGTAGCAAATTTGTACTATATCGATTACTGTAGCATAGATGGTGAAACAGGATGACAGCGAATCCG
CGGATTCGCTGTCATCCTGTTTCACCATCTATGCTACAGTAATCGATATAGTACAAATTTGCTACAGTATTTTCTGAACAGCATTTTCCTGCCACCTGAG[C/T]
CGTTGATTTTTTATCCATCGGCTGCACTGCAACTGCTAAAGTTGCAGATCTTGATCCTCAAATAACTTATTAACTTATTGGTAATAACTAGTTCTCTACT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.50% | 46.40% | 0.02% | 0.06% | NA |
| All Indica | 2759 | 79.90% | 20.00% | 0.04% | 0.07% | NA |
| All Japonica | 1512 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.00% | 2.60% | 0.00% | 0.37% | NA |
| Indica I | 595 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 54.00% | 45.60% | 0.22% | 0.22% | NA |
| Indica III | 913 | 82.10% | 17.70% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 80.90% | 19.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 21.90% | 78.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 34.40% | 65.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0601660746 | G -> A | LOC_Os06g04040-LOC_Os06g04060 | intergenic_region ; MODIFIER | silent_mutation | Average:52.535; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| vg0601660746 | G -> DEL | N | N | silent_mutation | Average:52.535; most accessible tissue: Zhenshan97 panicle, score: 79.071 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0601660746 | NA | 3.57E-12 | mr1050 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601660746 | NA | 3.72E-06 | mr1050 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601660746 | NA | 1.08E-15 | mr1059 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601660746 | 2.31E-07 | 8.14E-52 | mr1141 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601660746 | 1.58E-06 | 4.24E-15 | mr1141 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601660746 | NA | 2.43E-15 | mr1143 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601660746 | NA | 1.52E-15 | mr1167 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601660746 | NA | 2.32E-12 | mr1272 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601660746 | NA | 6.73E-10 | mr1399 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601660746 | NA | 2.96E-07 | mr1608 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601660746 | NA | 5.52E-14 | mr1726 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601660746 | NA | 1.29E-14 | mr1969 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601660746 | 6.18E-06 | 2.98E-59 | mr1141_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601660746 | NA | 4.40E-14 | mr1141_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601660746 | NA | 2.35E-14 | mr1790_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601660746 | NA | 3.96E-07 | mr1830_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |