\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601660746:

Variant ID: vg0601660746 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 1660746
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


AGTAGAGAACTAGTTATTACCAATAAGTTAATAAGTTATTTGAGGATCAAGATCTGCAACTTTAGCAGTTGCAGTGCAGCCGATGGATAAAAAATCAACG[G/A]
CTCAGGTGGCAGGAAAATGCTGTTCAGAAAATACTGTAGCAAATTTGTACTATATCGATTACTGTAGCATAGATGGTGAAACAGGATGACAGCGAATCCG

Reverse complement sequence

CGGATTCGCTGTCATCCTGTTTCACCATCTATGCTACAGTAATCGATATAGTACAAATTTGCTACAGTATTTTCTGAACAGCATTTTCCTGCCACCTGAG[C/T]
CGTTGATTTTTTATCCATCGGCTGCACTGCAACTGCTAAAGTTGCAGATCTTGATCCTCAAATAACTTATTAACTTATTGGTAATAACTAGTTCTCTACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.50% 46.40% 0.02% 0.06% NA
All Indica  2759 79.90% 20.00% 0.04% 0.07% NA
All Japonica  1512 0.80% 99.20% 0.00% 0.00% NA
Aus  269 97.00% 2.60% 0.00% 0.37% NA
Indica I  595 95.30% 4.70% 0.00% 0.00% NA
Indica II  465 54.00% 45.60% 0.22% 0.22% NA
Indica III  913 82.10% 17.70% 0.00% 0.11% NA
Indica Intermediate  786 80.90% 19.10% 0.00% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 1.20% 98.80% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 21.90% 78.10% 0.00% 0.00% NA
Intermediate  90 34.40% 65.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601660746 G -> A LOC_Os06g04040-LOC_Os06g04060 intergenic_region ; MODIFIER silent_mutation Average:52.535; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0601660746 G -> DEL N N silent_mutation Average:52.535; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601660746 NA 3.57E-12 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601660746 NA 3.72E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601660746 NA 1.08E-15 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601660746 2.31E-07 8.14E-52 mr1141 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601660746 1.58E-06 4.24E-15 mr1141 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601660746 NA 2.43E-15 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601660746 NA 1.52E-15 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601660746 NA 2.32E-12 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601660746 NA 6.73E-10 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601660746 NA 2.96E-07 mr1608 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601660746 NA 5.52E-14 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601660746 NA 1.29E-14 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601660746 6.18E-06 2.98E-59 mr1141_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601660746 NA 4.40E-14 mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601660746 NA 2.35E-14 mr1790_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601660746 NA 3.96E-07 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251