\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601634959:

Variant ID: vg0601634959 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 1634959
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCGTCTTATTCAAAAAATTTATGTAATTATAATTTATTTTGTTATGAGTTGTTTTATCACTCATAGTACTTTAAGTATGATTTATATCATATACATTTG[C/T]
ATAAAATTTTTGAATAAGACGAATGGTCAAATATGTGAGAAAAGGTTAACGGCGTCATCTATTAAAAAACGGAGGTAGTATTTGTCAGTGCGAATTCTCG

Reverse complement sequence

CGAGAATTCGCACTGACAAATACTACCTCCGTTTTTTAATAGATGACGCCGTTAACCTTTTCTCACATATTTGACCATTCGTCTTATTCAAAAATTTTAT[G/A]
CAAATGTATATGATATAAATCATACTTAAAGTACTATGAGTGATAAAACAACTCATAACAAAATAAATTATAATTACATAAATTTTTTGAATAAGACGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.70% 6.70% 6.81% 0.76% NA
All Indica  2759 87.70% 1.70% 9.21% 1.30% NA
All Japonica  1512 86.60% 13.40% 0.07% 0.00% NA
Aus  269 75.80% 1.90% 22.30% 0.00% NA
Indica I  595 91.40% 0.00% 8.07% 0.50% NA
Indica II  465 86.20% 6.00% 7.74% 0.00% NA
Indica III  913 85.40% 0.40% 11.17% 2.96% NA
Indica Intermediate  786 88.50% 2.00% 8.65% 0.76% NA
Temperate Japonica  767 99.60% 0.30% 0.13% 0.00% NA
Tropical Japonica  504 67.30% 32.70% 0.00% 0.00% NA
Japonica Intermediate  241 85.50% 14.50% 0.00% 0.00% NA
VI/Aromatic  96 51.00% 47.90% 1.04% 0.00% NA
Intermediate  90 73.30% 20.00% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601634959 C -> T LOC_Os06g04000.1 upstream_gene_variant ; 137.0bp to feature; MODIFIER silent_mutation Average:92.058; most accessible tissue: Minghui63 flag leaf, score: 95.901 N N N N
vg0601634959 C -> T LOC_Os06g03990.1 downstream_gene_variant ; 1330.0bp to feature; MODIFIER silent_mutation Average:92.058; most accessible tissue: Minghui63 flag leaf, score: 95.901 N N N N
vg0601634959 C -> T LOC_Os06g04010.1 downstream_gene_variant ; 1565.0bp to feature; MODIFIER silent_mutation Average:92.058; most accessible tissue: Minghui63 flag leaf, score: 95.901 N N N N
vg0601634959 C -> T LOC_Os06g04010.2 downstream_gene_variant ; 1569.0bp to feature; MODIFIER silent_mutation Average:92.058; most accessible tissue: Minghui63 flag leaf, score: 95.901 N N N N
vg0601634959 C -> T LOC_Os06g03990-LOC_Os06g04000 intergenic_region ; MODIFIER silent_mutation Average:92.058; most accessible tissue: Minghui63 flag leaf, score: 95.901 N N N N
vg0601634959 C -> DEL N N silent_mutation Average:92.058; most accessible tissue: Minghui63 flag leaf, score: 95.901 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0601634959 C T 0.01 0.01 0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601634959 NA 1.43E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601634959 3.00E-06 NA mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601634959 NA 3.31E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601634959 4.59E-06 NA mr1362_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601634959 NA 4.92E-06 mr1852_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251