\
| Variant ID: vg0601609792 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 1609792 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.01, others allele: 0.00, population size: 291. )
CGTCCAAGTAATGTAAGTGTGTTCCCTTGAAACACATGTAACTAACTATTATCTGTTTGAAGCCATCCTATCATCATGATTCAGCTGAACCAAAATTTAA[A/T]
TTCTCAGTGATATGTCCAACAACAACTTATCTGGTAGTCTGCCCGAGGAACTTGGACAACTTCAAAACCTTGATAGCCTGTGAGTTGTATATCATCATAA
TTATGATGATATACAACTCACAGGCTATCAAGGTTTTGAAGTTGTCCAAGTTCCTCGGGCAGACTACCAGATAAGTTGTTGTTGGACATATCACTGAGAA[T/A]
TTAAATTTTGGTTCAGCTGAATCATGATGATAGGATGGCTTCAAACAGATAATAGTTAGTTACATGTGTTTCAAGGGAACACACTTACATTACTTGGACG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.60% | 14.30% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 76.20% | 23.70% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Indica II | 465 | 90.80% | 9.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 60.00% | 39.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 76.70% | 23.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0601609792 | A -> T | LOC_Os06g03970.1 | splice_region_variant&intron_variant ; LOW | silent_mutation | Average:45.303; most accessible tissue: Callus, score: 68.805 | N | N | N | N |
| vg0601609792 | A -> T | LOC_Os06g03980.1 | downstream_gene_variant ; 3872.0bp to feature; MODIFIER | silent_mutation | Average:45.303; most accessible tissue: Callus, score: 68.805 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0601609792 | NA | 4.88E-07 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601609792 | NA | 4.53E-08 | mr1380_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601609792 | NA | 1.02E-07 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601609792 | NA | 4.64E-10 | mr1561_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601609792 | NA | 1.46E-09 | mr1561_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601609792 | NA | 3.57E-08 | mr1798_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601609792 | NA | 1.82E-07 | mr1875_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601609792 | NA | 1.44E-06 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601609792 | NA | 5.15E-08 | mr1908_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601609792 | NA | 1.72E-07 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601609792 | NA | 5.32E-07 | mr1996_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0601609792 | NA | 8.27E-07 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |