\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601609792:

Variant ID: vg0601609792 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 1609792
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.01, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


CGTCCAAGTAATGTAAGTGTGTTCCCTTGAAACACATGTAACTAACTATTATCTGTTTGAAGCCATCCTATCATCATGATTCAGCTGAACCAAAATTTAA[A/T]
TTCTCAGTGATATGTCCAACAACAACTTATCTGGTAGTCTGCCCGAGGAACTTGGACAACTTCAAAACCTTGATAGCCTGTGAGTTGTATATCATCATAA

Reverse complement sequence

TTATGATGATATACAACTCACAGGCTATCAAGGTTTTGAAGTTGTCCAAGTTCCTCGGGCAGACTACCAGATAAGTTGTTGTTGGACATATCACTGAGAA[T/A]
TTAAATTTTGGTTCAGCTGAATCATGATGATAGGATGGCTTCAAACAGATAATAGTTAGTTACATGTGTTTCAAGGGAACACACTTACATTACTTGGACG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.60% 14.30% 0.04% 0.00% NA
All Indica  2759 76.20% 23.70% 0.07% 0.00% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 88.90% 11.10% 0.00% 0.00% NA
Indica II  465 90.80% 9.20% 0.00% 0.00% NA
Indica III  913 60.00% 39.90% 0.11% 0.00% NA
Indica Intermediate  786 76.70% 23.20% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601609792 A -> T LOC_Os06g03970.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:45.303; most accessible tissue: Callus, score: 68.805 N N N N
vg0601609792 A -> T LOC_Os06g03980.1 downstream_gene_variant ; 3872.0bp to feature; MODIFIER silent_mutation Average:45.303; most accessible tissue: Callus, score: 68.805 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601609792 NA 4.88E-07 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601609792 NA 4.53E-08 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601609792 NA 1.02E-07 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601609792 NA 4.64E-10 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601609792 NA 1.46E-09 mr1561_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601609792 NA 3.57E-08 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601609792 NA 1.82E-07 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601609792 NA 1.44E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601609792 NA 5.15E-08 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601609792 NA 1.72E-07 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601609792 NA 5.32E-07 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601609792 NA 8.27E-07 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251