\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0601409744:

Variant ID: vg0601409744 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 1409744
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


GCCTTGTTGCGACTAATAGGAAGGTTCATCAGTGATGAAATGAATAGTGAGGCTTCGTTCTGGCATCCCTAGGGGGCGATCTCGTCTGTGTCTCTTTGTT[G/T,A]
GTCTAGCGGCGGTCGGTCACGCTTAACGGCGGTCGATCCGGTGCTAGCCTTCTCCTGGGATTATGTGTTGGCGATGTCGGTGTGTGGGTGGTTGTATATT

Reverse complement sequence

AATATACAACCACCCACACACCGACATCGCCAACACATAATCCCAGGAGAAGGCTAGCACCGGATCGACCGCCGTTAAGCGTGACCGACCGCCGCTAGAC[C/A,T]
AACAAAGAGACACAGACGAGATCGCCCCCTAGGGATGCCAGAACGAAGCCTCACTATTCATTTCATCACTGATGAACCTTCCTATTAGTCGCAACAAGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.10% 9.10% 0.63% 0.00% A: 7.15%
All Indica  2759 86.50% 10.70% 0.04% 0.00% A: 2.75%
All Japonica  1512 83.60% 0.10% 1.72% 0.00% A: 14.55%
Aus  269 63.20% 32.70% 0.74% 0.00% A: 3.35%
Indica I  595 94.50% 5.20% 0.00% 0.00% A: 0.34%
Indica II  465 86.50% 5.60% 0.00% 0.00% A: 7.96%
Indica III  913 80.30% 18.00% 0.00% 0.00% A: 1.75%
Indica Intermediate  786 87.80% 9.40% 0.13% 0.00% A: 2.67%
Temperate Japonica  767 94.90% 0.00% 2.74% 0.00% A: 2.35%
Tropical Japonica  504 70.00% 0.20% 0.00% 0.00% A: 29.76%
Japonica Intermediate  241 75.90% 0.40% 2.07% 0.00% A: 21.58%
VI/Aromatic  96 37.50% 38.50% 0.00% 0.00% A: 23.96%
Intermediate  90 80.00% 7.80% 1.11% 0.00% A: 11.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0601409744 G -> T LOC_Os06g03630.1 upstream_gene_variant ; 3137.0bp to feature; MODIFIER silent_mutation Average:71.728; most accessible tissue: Zhenshan97 root, score: 90.883 N N N N
vg0601409744 G -> T LOC_Os06g03640.1 upstream_gene_variant ; 4477.0bp to feature; MODIFIER silent_mutation Average:71.728; most accessible tissue: Zhenshan97 root, score: 90.883 N N N N
vg0601409744 G -> T LOC_Os06g03630-LOC_Os06g03640 intergenic_region ; MODIFIER silent_mutation Average:71.728; most accessible tissue: Zhenshan97 root, score: 90.883 N N N N
vg0601409744 G -> A LOC_Os06g03630.1 upstream_gene_variant ; 3137.0bp to feature; MODIFIER silent_mutation Average:71.728; most accessible tissue: Zhenshan97 root, score: 90.883 N N N N
vg0601409744 G -> A LOC_Os06g03640.1 upstream_gene_variant ; 4477.0bp to feature; MODIFIER silent_mutation Average:71.728; most accessible tissue: Zhenshan97 root, score: 90.883 N N N N
vg0601409744 G -> A LOC_Os06g03630-LOC_Os06g03640 intergenic_region ; MODIFIER silent_mutation Average:71.728; most accessible tissue: Zhenshan97 root, score: 90.883 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0601409744 G A 0.03 -0.01 -0.01 0.0 0.0 -0.01
vg0601409744 G T 0.07 -0.01 0.0 -0.04 0.0 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0601409744 NA 3.44E-06 mr1297 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601409744 NA 6.92E-09 mr1310 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601409744 NA 6.71E-11 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601409744 NA 6.18E-09 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601409744 NA 3.98E-10 mr1896 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601409744 NA 3.71E-09 mr1903 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601409744 NA 2.38E-12 mr1907 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601409744 NA 2.59E-09 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601409744 NA 3.47E-08 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601409744 NA 1.07E-06 mr1956 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601409744 NA 3.25E-06 mr1168_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601409744 8.69E-07 NA mr1252_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601409744 7.01E-06 4.79E-08 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601409744 NA 1.02E-07 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601409744 NA 2.79E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601409744 NA 5.31E-07 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601409744 NA 7.35E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601409744 1.48E-06 1.48E-06 mr1597_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601409744 NA 9.07E-07 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601409744 NA 6.95E-06 mr1679_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601409744 NA 1.31E-06 mr1720_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601409744 NA 8.52E-07 mr1896_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601409744 NA 5.73E-06 mr1899_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601409744 NA 3.40E-09 mr1934_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0601409744 NA 8.36E-07 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251